ID: 1002462327

View in Genome Browser
Species Human (GRCh38)
Location 5:179380599-179380621
Sequence CCCATACCCGCCAGGCCGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002462324_1002462327 -5 Left 1002462324 5:179380581-179380603 CCTTGAGAGAGGCAGCTTCCCAT No data
Right 1002462327 5:179380599-179380621 CCCATACCCGCCAGGCCGACAGG No data
1002462316_1002462327 30 Left 1002462316 5:179380546-179380568 CCAGCAGGAAACCTTCGAGGAAC No data
Right 1002462327 5:179380599-179380621 CCCATACCCGCCAGGCCGACAGG No data
1002462322_1002462327 -3 Left 1002462322 5:179380579-179380601 CCCCTTGAGAGAGGCAGCTTCCC No data
Right 1002462327 5:179380599-179380621 CCCATACCCGCCAGGCCGACAGG No data
1002462323_1002462327 -4 Left 1002462323 5:179380580-179380602 CCCTTGAGAGAGGCAGCTTCCCA No data
Right 1002462327 5:179380599-179380621 CCCATACCCGCCAGGCCGACAGG No data
1002462319_1002462327 19 Left 1002462319 5:179380557-179380579 CCTTCGAGGAACCATGGAGCGGC No data
Right 1002462327 5:179380599-179380621 CCCATACCCGCCAGGCCGACAGG No data
1002462320_1002462327 8 Left 1002462320 5:179380568-179380590 CCATGGAGCGGCCCCTTGAGAGA No data
Right 1002462327 5:179380599-179380621 CCCATACCCGCCAGGCCGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002462327 Original CRISPR CCCATACCCGCCAGGCCGAC AGG Intergenic
No off target data available for this crispr