ID: 1002462331

View in Genome Browser
Species Human (GRCh38)
Location 5:179380606-179380628
Sequence CCGCCAGGCCGACAGGAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002462319_1002462331 26 Left 1002462319 5:179380557-179380579 CCTTCGAGGAACCATGGAGCGGC No data
Right 1002462331 5:179380606-179380628 CCGCCAGGCCGACAGGAAGCCGG No data
1002462323_1002462331 3 Left 1002462323 5:179380580-179380602 CCCTTGAGAGAGGCAGCTTCCCA No data
Right 1002462331 5:179380606-179380628 CCGCCAGGCCGACAGGAAGCCGG No data
1002462322_1002462331 4 Left 1002462322 5:179380579-179380601 CCCCTTGAGAGAGGCAGCTTCCC No data
Right 1002462331 5:179380606-179380628 CCGCCAGGCCGACAGGAAGCCGG No data
1002462320_1002462331 15 Left 1002462320 5:179380568-179380590 CCATGGAGCGGCCCCTTGAGAGA No data
Right 1002462331 5:179380606-179380628 CCGCCAGGCCGACAGGAAGCCGG No data
1002462324_1002462331 2 Left 1002462324 5:179380581-179380603 CCTTGAGAGAGGCAGCTTCCCAT No data
Right 1002462331 5:179380606-179380628 CCGCCAGGCCGACAGGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002462331 Original CRISPR CCGCCAGGCCGACAGGAAGC CGG Intergenic