ID: 1002463582

View in Genome Browser
Species Human (GRCh38)
Location 5:179389608-179389630
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 2, 1: 9, 2: 40, 3: 97, 4: 308}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002463582_1002463590 21 Left 1002463582 5:179389608-179389630 CCATGTCTGGAGACATTTTTGAC 0: 2
1: 9
2: 40
3: 97
4: 308
Right 1002463590 5:179389652-179389674 TGCCTGCCATCTTGTGGGTAGGG No data
1002463582_1002463589 20 Left 1002463582 5:179389608-179389630 CCATGTCTGGAGACATTTTTGAC 0: 2
1: 9
2: 40
3: 97
4: 308
Right 1002463589 5:179389651-179389673 CTGCCTGCCATCTTGTGGGTAGG No data
1002463582_1002463586 -8 Left 1002463582 5:179389608-179389630 CCATGTCTGGAGACATTTTTGAC 0: 2
1: 9
2: 40
3: 97
4: 308
Right 1002463586 5:179389623-179389645 TTTTTGACTGTCATCAGGGGAGG No data
1002463582_1002463587 15 Left 1002463582 5:179389608-179389630 CCATGTCTGGAGACATTTTTGAC 0: 2
1: 9
2: 40
3: 97
4: 308
Right 1002463587 5:179389646-179389668 TGCTACTGCCTGCCATCTTGTGG No data
1002463582_1002463588 16 Left 1002463582 5:179389608-179389630 CCATGTCTGGAGACATTTTTGAC 0: 2
1: 9
2: 40
3: 97
4: 308
Right 1002463588 5:179389647-179389669 GCTACTGCCTGCCATCTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002463582 Original CRISPR GTCAAAAATGTCTCCAGACA TGG (reversed) Intergenic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902039114 1:13480047-13480069 ATCAAAACTGTCTCCAGTCCGGG + Intronic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
903530423 1:24026117-24026139 TACAAAAATGTAGCCAGACATGG - Intergenic
904545465 1:31267361-31267383 GTCTAAAATGTCTCCAAAGTGGG + Intronic
904744758 1:32703598-32703620 GTCAAAGACCTCCCCAGACAGGG - Intergenic
905217152 1:36416870-36416892 ATGTAAAATGTCTCCAGCCAGGG - Intronic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907851402 1:58258508-58258530 ATGAAAAATGAGTCCAGACAGGG - Intronic
907915338 1:58863385-58863407 GTCAAGAATGTCTGAACACATGG + Intergenic
908022255 1:59910134-59910156 GTCAAAAATATATCCAGCCTTGG + Intronic
910368952 1:86495916-86495938 ATCAAAAATGTCTCCATATGTGG + Intronic
910451633 1:87352577-87352599 GTCACAAATGTGTCCAGAGTGGG - Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913265802 1:117042670-117042692 TCCAAAAGTGTCTCCAAACAGGG + Intergenic
914202256 1:145496064-145496086 ATCAAAAATGTCTACAGGCTGGG + Intergenic
914236186 1:145813979-145814001 ATCAAAAATGTCTACAGGCTGGG + Intronic
914481382 1:148069206-148069228 ATCAAAAATGTCTACAGGCTGGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
915661623 1:157410075-157410097 GTCCAACAGGTCCCCAGACACGG - Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918565498 1:185925762-185925784 ATCAAAAAGGTATCCAGAGAAGG + Intronic
919147723 1:193656063-193656085 GTCAAAAGTCTCTCAAGAGAGGG - Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
923633075 1:235667816-235667838 TTCAAAAATTTAGCCAGACATGG - Intronic
923915163 1:238494207-238494229 GTCAAAAATTTCTACAAAAATGG + Intergenic
924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG + Intronic
1065280847 10:24135987-24136009 GTTAAAATTGTCTCCAAACTAGG - Intronic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1066666929 10:37792221-37792243 GTCTTACATGTCTCCATACATGG - Intronic
1068164807 10:53315626-53315648 GTCAAAACTGTCACCAAACTAGG - Intergenic
1068165500 10:53326673-53326695 AACAAAAATGACTCCTGACACGG - Intergenic
1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG + Intergenic
1069025111 10:63531399-63531421 GCCAAAAATGGCTCCAGATATGG + Intronic
1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG + Intergenic
1069520660 10:69117570-69117592 ATCAAAACTGTCTCCAGGCCGGG + Intergenic
1071156135 10:82691702-82691724 GTCAAACATTGCTCCAGGCATGG + Intronic
1072328242 10:94319713-94319735 GTCAAACATGTACACAGACAAGG + Intronic
1073138865 10:101234753-101234775 GACAAAAATGGAGCCAGACAGGG + Intergenic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1077592565 11:3503981-3504003 CTCAAAGTTGTCTCCAGACCAGG - Intergenic
1077806830 11:5598705-5598727 GTCAAACATGTAGCCAGATATGG - Intronic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1079372758 11:19865549-19865571 GTTAAAAATCACTCCTGACAAGG - Intronic
1079415011 11:20225887-20225909 TTCTAAAATGTCTACAGATAAGG + Intergenic
1081522064 11:43891669-43891691 GCCACAAATTTCTGCAGACAGGG + Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084248402 11:67876705-67876727 CTCAAAGTTGTCTCCAGACCAGG - Intergenic
1084824420 11:71718776-71718798 GTCAAAGTTGTCTCCAGACCAGG + Intergenic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085353966 11:75818986-75819008 ATCAAAAATGAGTTCAGACATGG + Intronic
1085700837 11:78744670-78744692 CTCAAAAATGTTTACAGAAAGGG - Intronic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1087122056 11:94585112-94585134 GTCAAAAAGGCCTGCAGGCATGG + Intronic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092770787 12:11894694-11894716 TTCAAAAATGTATTCAGACTTGG - Exonic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1093799346 12:23353318-23353340 GTCAAGAATATTTCCAGAAATGG + Intergenic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1094320440 12:29177056-29177078 GTCAATATTGTCTCAAGCCAAGG + Intronic
1094475826 12:30839915-30839937 GTTAGACAAGTCTCCAGACAGGG + Intergenic
1095378107 12:41555973-41555995 GTCAAATTTGACTCCAGAGATGG - Intronic
1097789915 12:63804146-63804168 ATCAAAAACGTCTCCAGGCCAGG - Intronic
1098808707 12:75055549-75055571 GTTAGAAAGCTCTCCAGACAAGG + Intronic
1098815420 12:75155146-75155168 GCCAAAAATTTCTGCAGGCATGG - Intronic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1100281232 12:93120175-93120197 ATCATGAATGCCTCCAGACAAGG - Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101317116 12:103639405-103639427 CTCAAAAATGTTTCCAGGCTGGG + Intronic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102401392 12:112632694-112632716 ATCAAAATTGTCTCCAGGCATGG - Intronic
1102596502 12:113996821-113996843 ATAAAAAATGTCTCCAGGCCAGG + Intergenic
1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1106951622 13:34890822-34890844 CTAAAAAATGTCTACAGACTGGG - Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1110040925 13:70757388-70757410 TTCATAAATGCTTCCAGACAAGG - Intergenic
1110283878 13:73727081-73727103 GTCAAACATTTCTCCAGAGAAGG - Intronic
1110523124 13:76504458-76504480 CTCATAAATGTCTCCAGATGAGG - Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112501706 13:99947923-99947945 GTCAAAAATGTCTCCAGGCTGGG - Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1116618133 14:47164319-47164341 GTAAAAATTTTCTCCAGAAATGG - Intronic
1117034591 14:51715150-51715172 TTCAAAAATGTCACAGGACAGGG - Intronic
1118455233 14:65939889-65939911 GTCAAAAATCTCTGGAAACACGG - Intergenic
1119222567 14:72920959-72920981 TTCAAAATTGTATCCACACATGG + Intergenic
1119781949 14:77281803-77281825 GCCAAAAATTTCTCCACAGATGG + Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1122053569 14:99076923-99076945 GTGAAAAATGTTTCCATAGAAGG + Intergenic
1123712554 15:22999554-22999576 ATACAAAATGTATCCAGACATGG - Exonic
1124946052 15:34267551-34267573 GTCAGAGATGTCTCCAGGCTGGG + Intronic
1125276417 15:37996773-37996795 GTCCAAAATGTCTTCAGACCTGG + Intergenic
1129163111 15:73758579-73758601 GACAGAAATGTCCTCAGACATGG - Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130110877 15:80963904-80963926 CTGAAAACTGGCTCCAGACAAGG + Intronic
1130385358 15:83406749-83406771 ATCACAACTCTCTCCAGACAAGG - Intergenic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131205092 15:90437832-90437854 TTCAAAAAATTCTCCAGACTGGG - Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1132660952 16:1061331-1061353 CTCTTAAATGTCTCCAGAAATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1133828697 16:9302002-9302024 GTCCCAGATGTCTCCAGAAAGGG - Intergenic
1134009218 16:10838875-10838897 ATGCAGAATGTCTCCAGACATGG + Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1138969111 16:62123576-62123598 ATCAAAAAAGTATCCAGGCATGG - Intergenic
1139285762 16:65812537-65812559 GGAAAAAATGTCTACTGACAGGG - Intergenic
1139363438 16:66418177-66418199 GTCAGAAAAGCCTCCAGAGAAGG + Intergenic
1140289864 16:73643319-73643341 CTTAAAAATATCTCCAGAAAAGG - Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140755965 16:78066880-78066902 GTTAAAAATGTTTCTAGGCACGG + Intergenic
1140954117 16:79846742-79846764 AACAAAAATGTCTCCATGCATGG - Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1143965009 17:10750879-10750901 ATCAAAAATGTTTCCAGATGTGG + Intergenic
1144488923 17:15691210-15691232 GTTTATAATGTGTCCAGACAAGG + Intergenic
1144662544 17:17080555-17080577 ATCAAGGATGACTCCAGACATGG - Intronic
1144714331 17:17423807-17423829 GTCAAACATGCCACCACACAAGG - Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1144912097 17:18691093-18691115 GTTTATAATGTGTCCAGACAAGG - Intergenic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147909083 17:43844071-43844093 ATCAAAAATGTCTCCAGGCTGGG - Intergenic
1147916819 17:43892762-43892784 GCCAAAAACGTTTCCAGAGAAGG + Intronic
1148763015 17:50017975-50017997 GTAAAAAATGTAGCCAGGCACGG - Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1150523917 17:65901649-65901671 GATAAAAATGACTCCAGAGAAGG - Intronic
1151102530 17:71572328-71572350 GCCAAAAGTGTCTCCAAACATGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1153516506 18:5907620-5907642 TTAAAAAATGTCTGCAGACTGGG - Intergenic
1154154201 18:11930971-11930993 TTCAATAATGTCTCCATAAAAGG - Intergenic
1157488964 18:48108998-48109020 CTGAAAAATGTCTCCTGCCAGGG - Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1160130949 18:76224426-76224448 GTCCCATATGTGTCCAGACACGG + Intergenic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161880665 19:6949470-6949492 ATCAAAAATGCCTCCAGAGGGGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1163240353 19:16059018-16059040 GTCAAAACTGTTTCTGGACACGG - Intergenic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163540205 19:17904336-17904358 ATCAAAATTGTTTCCAGACATGG + Intergenic
1163706278 19:18815430-18815452 GTGAAAAATGTAGCCAGGCATGG + Intergenic
1164144511 19:22503745-22503767 CTCAAAAATGTTGGCAGACATGG + Intronic
1164449420 19:28347613-28347635 ATCAAAAATTTTTCCAGAAAGGG + Intergenic
1164946239 19:32295422-32295444 GTCCAAAATGTCCAAAGACAAGG + Intergenic
1165292401 19:34897992-34898014 GTCAAAAATATCTACAGAATAGG + Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1166159104 19:40938380-40938402 GTTAAAAATGTAGCCAGACATGG - Intergenic
1168416948 19:56175344-56175366 AACAAAACTGTCTCCAGACTTGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
926176651 2:10598920-10598942 GTCAAAAATGTTTAAAGGCATGG + Intronic
926713516 2:15903625-15903647 TTCAAAAATTTTTCGAGACAGGG - Intergenic
929083514 2:38145704-38145726 GTCAGAAATTTCTACAGAGATGG + Intergenic
929085714 2:38165314-38165336 AACCAAAAAGTCTCCAGACATGG - Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
929651726 2:43686490-43686512 GTCAAAAATGACTTCAGGCCGGG - Intronic
929864103 2:45703380-45703402 TTGAAAAATGTAGCCAGACATGG + Intronic
933085061 2:78045836-78045858 GGGGAAAATGTCTCCAGAGACGG + Intergenic
935671829 2:105562556-105562578 ATCAAAAATGTCTTCAGGCGGGG + Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937336301 2:121064415-121064437 ATCAAAACTGGCTCCAGACCAGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
938792495 2:134689396-134689418 TTAAAAATTGTCTCCAGGCATGG - Intronic
938941178 2:136170923-136170945 TTCAACAATGTCTCCAGTCCAGG + Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
940797406 2:158095096-158095118 GACAGAAATTGCTCCAGACAGGG + Intronic
940806820 2:158196607-158196629 GTCCAACATGTCTCAAGCCAAGG + Intronic
941052192 2:160747635-160747657 ATAAAAAATGTCTGCAGTCATGG - Intergenic
942139127 2:172959639-172959661 GAGAAAAATGTATCCAGTCAAGG - Intronic
942773823 2:179556560-179556582 GCCAAAATTATCTCCAGACAGGG + Intronic
943673983 2:190698624-190698646 TTCAAAAAATTATCCAGACATGG - Intergenic
943695474 2:190925007-190925029 TTCAAAAATGTCTTCATAAAAGG + Intronic
943708540 2:191062208-191062230 ATAAAAAATGTATCCAGGCATGG - Intronic
944204791 2:197146264-197146286 GTAAAAAATGTCTTCAGGGAAGG - Intronic
945939452 2:215933506-215933528 GCTAAGAATGTCTCCAGATATGG + Intergenic
946311004 2:218882605-218882627 GGCAAATGTGTCTCCAGACTGGG + Intronic
947071673 2:226294477-226294499 GCCAAAACTGTCTCCAGATTTGG - Intergenic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
947847968 2:233260866-233260888 GGCAAAGATTTCCCCAGACAAGG - Intronic
947917841 2:233846038-233846060 GTCATAAACTTCTCTAGACATGG - Intronic
948110214 2:235448908-235448930 GTCAGAGATGTCTCCACAAAAGG + Intergenic
1169170144 20:3458172-3458194 GTCAAAAATGTCTTGAGGCTGGG + Intergenic
1170288816 20:14744665-14744687 GTCAAAAATGGCTCAAGCAAAGG + Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1170577889 20:17678362-17678384 GTAAAAAATCTCTCCAGGAAAGG + Intronic
1170798606 20:19571514-19571536 CTGAAAAATTTCTCCAGAGATGG + Intronic
1170926923 20:20733301-20733323 GTAAAAAAAGTAGCCAGACATGG + Intergenic
1172297640 20:33824667-33824689 GTCCAAAATGTCAGCAGTCAAGG - Intronic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173114321 20:40225587-40225609 GCCAAAACTGTCTCCACACATGG - Intergenic
1174177551 20:48654526-48654548 AACAAAAATGTCTCCGGGCAGGG + Intronic
1174204750 20:48830066-48830088 ATCAAAAATGTCTCCAGGCTGGG + Intergenic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175427669 20:58879422-58879444 GTCAAAAAGGTCCCCAGAACAGG - Intronic
1175545619 20:59775974-59775996 ATCTAAAATGTCTCCAGACTTGG + Intronic
1178374700 21:32057057-32057079 GTCAAAGACGTCTTCAGGCATGG - Intergenic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179931982 21:44576598-44576620 GTTAAAAATAACTCCAGAGAAGG + Intronic
1180781861 22:18524976-18524998 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181238747 22:21464320-21464342 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181989257 22:26824687-26824709 GTAAAATAGGTCTCCAGATAAGG - Intergenic
1182521189 22:30885311-30885333 TTCAAGAATGTGTCCAGAAAGGG + Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
949843046 3:8340743-8340765 GACAAAAATGTCTACATTCACGG - Intergenic
950897696 3:16468392-16468414 GTCAAAAATGTCCCCACCCTGGG + Intronic
951848726 3:27114318-27114340 TTCAAAAATCTCTCCAGGGATGG + Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952266806 3:31794765-31794787 GTGAAAAATGTCTCCCAAGATGG - Intronic
953000704 3:38930760-38930782 GTTAAAAATGTCTTCATACAAGG - Intronic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953800226 3:46017311-46017333 GACAAAAAGGTCTGCAAACATGG - Exonic
955063925 3:55518119-55518141 ATCAAAAATGTCTCAGGACATGG + Intronic
955287477 3:57656800-57656822 TACAAAAATGTAGCCAGACATGG + Intronic
955337697 3:58100543-58100565 GTAAAAAATGTAACCAGGCATGG - Intronic
955506065 3:59634433-59634455 ATTTAAAATCTCTCCAGACATGG - Intergenic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
955775570 3:62428812-62428834 GAAGAAAATGTCTCCAGATATGG - Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
957987993 3:87595922-87595944 GCCAAAATTGCCTCCAGACTAGG + Intergenic
958896950 3:99840004-99840026 GACAATAATATCTCCAGACATGG - Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
961896362 3:130171328-130171350 CTCAAAGTTGTCTCCAGACCAGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
963151610 3:142051242-142051264 ATCAAAAATGTCTCCAGGCCTGG + Intronic
963398434 3:144764076-144764098 GTCAGAAATGTGTCCTGAGACGG - Intergenic
963646064 3:147915910-147915932 ATCAAAAATGTCTCCAGGCCGGG - Intergenic
963897460 3:150702569-150702591 ATCAAAAATGTCTCCAGGCCGGG - Intronic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964341146 3:155709771-155709793 GTCAAAAAATTAGCCAGACATGG - Intronic
964917636 3:161855363-161855385 GTCAAAAATATCCCCAAAAAGGG - Intergenic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
971400586 4:26272018-26272040 CTTAAAAATGTCTCCTGACTAGG + Intronic
972297999 4:37758550-37758572 GTGAAAAATTGCTGCAGACAAGG + Intergenic
972633600 4:40863002-40863024 TTCAAAACTGTTTCCAGAGAAGG + Intronic
972980083 4:44687282-44687304 TTCAATAATTTCTACAGACAAGG - Intronic
973125552 4:46579728-46579750 GTCAAAAGTGTTCCCAAACAAGG + Intergenic
973561856 4:52144916-52144938 TTCAATATGGTCTCCAGACATGG + Intergenic
973695565 4:53487148-53487170 GTCAAACATGCCACCACACAAGG + Intronic
973700625 4:53533693-53533715 ATCAAAAATGTCTCCAGGCTGGG - Intronic
973747643 4:53980129-53980151 GTCAAAAATTTCTTCAGGCTGGG + Intronic
974906119 4:68059603-68059625 GTCATAAATGTCTACATGCAAGG + Intronic
976058363 4:81096378-81096400 GTTAAAAAATTATCCAGACATGG + Intronic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
977376894 4:96216967-96216989 GTAAAAAATGTCTCCAAACGTGG + Intergenic
978343185 4:107738875-107738897 GGCTAGAATGTCTCCAGACAAGG + Intergenic
978627381 4:110702663-110702685 GTAAGAAATTTCTACAGACATGG - Intergenic
981053271 4:140332670-140332692 GTCAAAGATGACTCCAGGCCGGG - Intronic
981735840 4:147949457-147949479 ATCAGTAATGTCTCCAAACATGG - Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984041311 4:174737665-174737687 ATACAAAATTTCTCCAGACATGG - Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
985258014 4:188088756-188088778 CTAAAAAATTGCTCCAGACATGG + Intergenic
985987936 5:3533171-3533193 GGCCAAAGTGTCTCCAGACCTGG - Intergenic
986120414 5:4830697-4830719 GTCAAGAACATCTCCAAACATGG - Intergenic
986668864 5:10126231-10126253 GTGAGAAATGACTCCAGACTGGG + Intergenic
986704831 5:10446361-10446383 ATCAAAAATGTCTCCAGGCCGGG + Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987164545 5:15181672-15181694 GCTAAAAATGTATTCAGACAAGG - Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
989226830 5:39038396-39038418 TTCAAAAATGGCACAAGACAGGG + Intronic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990334983 5:54763843-54763865 ATCAAAAACGTCTTCTGACAAGG - Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993514245 5:88810752-88810774 GACAAAAATGTCTCCTGGGATGG - Intronic
993552264 5:89288306-89288328 GTCAAAATTGTCCCAAGAAATGG - Intergenic
993927127 5:93880213-93880235 CCCAAAAATGTATCCTGACAAGG - Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
995453215 5:112325618-112325640 TTCAAAAATGTCTTAAGAAAAGG + Intronic
996611378 5:125384007-125384029 GTAAATAATATCTCCAGAAAAGG - Intergenic
997633777 5:135389837-135389859 GTCACAAATGTCTCCTGAAAAGG + Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
999551753 5:152695152-152695174 GGGAAAAATGTCTCCACATAGGG - Intergenic
1000041821 5:157490246-157490268 GTCACAAAGGTCTCCATAAATGG - Intronic
1000221854 5:159222148-159222170 TTAAAAAATGTGTCCAAACACGG + Intergenic
1000497238 5:162000013-162000035 ATCAAAATTGTCTCCAGAAGTGG + Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003318720 6:5034062-5034084 GTTTAAAATGTCCCCAGGCACGG + Intergenic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005187092 6:23174702-23174724 ATCAAAATTTTCTCCATACATGG + Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006008566 6:31022832-31022854 GTCAAAAATGACTCAGGTCATGG + Intronic
1006705139 6:36013474-36013496 ATCAAAAATGTCTCCGGGCCAGG - Intronic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007218930 6:40263205-40263227 GTCAAAAATGTCTGGAGGCCAGG + Intergenic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014635979 6:123847190-123847212 GATAAAAATGTCTTCAGAGATGG - Intronic
1015731042 6:136348581-136348603 GTCCAAAATGTGTACAGGCAGGG + Intronic
1016720448 6:147290051-147290073 TTTAAAAATGTATCCAGACATGG + Intronic
1017264107 6:152422656-152422678 TTCAAAAAAGTATCCAGGCATGG - Intronic
1017908435 6:158772591-158772613 GTCCCAAATGTTTCCAGTCATGG - Intronic
1018272563 6:162096007-162096029 GTGAAAAATGTGTCCATACAGGG + Intronic
1019813466 7:3182321-3182343 TTCAAAAATGTAGCCAGGCATGG - Intergenic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020327066 7:6982964-6982986 CTCAAAGTTGTCTCCAGACCAGG - Intergenic
1020728583 7:11849432-11849454 CTCTAAAATGTCTCTGGACACGG + Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1021854176 7:24837497-24837519 TTCAAAAATGACTACAGGCAAGG - Intronic
1022282773 7:28927606-28927628 AACACAAATCTCTCCAGACAAGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022438400 7:30411877-30411899 ATCTAAAATGTCTCCTTACAGGG + Intronic
1022441133 7:30434360-30434382 ATCAAAAATGCCTCCGGACATGG - Intronic
1023738744 7:43258545-43258567 GTCAAGAATGTCTCCAAAACTGG + Intronic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1026031984 7:66802187-66802209 TTTAAAAATGTCTCCAGGCCTGG - Intronic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1028209604 7:88057248-88057270 TTCAAAAATGTGGCCAGGCATGG - Intronic
1028759144 7:94475552-94475574 GGCAGGAATGTCTGCAGACAAGG + Intergenic
1029335137 7:99892423-99892445 TTCAAAAATGTCCCCAGATGTGG - Exonic
1029835049 7:103300581-103300603 GTCAAAACAGTCTACAAACATGG - Intronic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1031261863 7:119531800-119531822 CTCAAAAATGACTCCTGCCATGG - Intergenic
1031853727 7:126897460-126897482 GTGAAAAATGTGTAAAGACAGGG + Intronic
1031946062 7:127841777-127841799 GTGAGAAATGTGTTCAGACAGGG - Intronic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1033430768 7:141287690-141287712 TTTGAAAATGTCCCCAGACATGG + Intronic
1034935234 7:155194969-155194991 ATCCAAACTGTCCCCAGACATGG - Intergenic
1036369564 8:8151123-8151145 CTCAAAGTTGTCTCCAGACCAGG + Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1036881324 8:12514521-12514543 CTCAAAGTTGTCTCCAGACCAGG - Intergenic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1037779401 8:21857432-21857454 TTCAAAAAAGTGTCCAGGCATGG + Intergenic
1039890554 8:41682825-41682847 GTCAAAGAAGTCTCGACACATGG + Intronic
1040023872 8:42764045-42764067 GTCTGAAGTGTCTCCAGAGAGGG - Intronic
1041853633 8:62422650-62422672 GTCAGAAATTTTTCAAGACAGGG + Intronic
1042719163 8:71808240-71808262 GTCAAATGTGTCCACAGACACGG - Intergenic
1045566042 8:103316756-103316778 GTCATAAATGTTTCCAGAGGGGG - Intronic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046617051 8:116489258-116489280 ATCAAAAATGCCTCCAGACGTGG + Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048054501 8:130850457-130850479 GTTAAAGATGCCTCCAGAGATGG - Intronic
1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG + Intronic
1049654484 8:143791717-143791739 GTCAAACTTCTTTCCAGACAAGG + Exonic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1051002335 9:12298767-12298789 GTCAAAAATTTATCCAGGCACGG - Intergenic
1052182962 9:25553311-25553333 GTCAAAAATGTGGCAGGACAAGG + Intergenic
1053297334 9:36924295-36924317 GTCAGAATGGTCTCCAGAGAAGG + Intronic
1053597041 9:39573376-39573398 GTCAAAGATGTCTGGAGGCATGG - Intergenic
1053855072 9:42330359-42330381 GTCAAAGATGTCTGGAGGCATGG - Intergenic
1054569215 9:66791621-66791643 GTCAAAGATGTCTGGAGGCATGG + Intergenic
1054849854 9:69836433-69836455 CGCAACAATGTCTCCAGGCATGG + Intronic
1055459693 9:76507419-76507441 ATAAAAAATTTCTGCAGACAAGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056202008 9:84285964-84285986 GTCAAACATGTTTCCAAACCAGG + Exonic
1056417018 9:86386593-86386615 ATCAAATATGTCTCCAGATCTGG + Intergenic
1057964324 9:99488542-99488564 GTCACAAATGTCAGCAGAGAGGG - Intergenic
1059015988 9:110516384-110516406 GTCACAAATCTCTCCAGATCTGG - Intronic
1059604779 9:115822743-115822765 ATCAATAGTGTCTCCAGATAAGG - Intergenic
1059787413 9:117600522-117600544 GTCAAAAATGTCCCAAGTCTTGG + Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060560501 9:124538605-124538627 GTTAAAAAACTGTCCAGACATGG - Intronic
1060708024 9:125824753-125824775 GACAACAAAGTCTCCAGAAATGG + Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061539853 9:131272352-131272374 GTCAATAATGTCCCCAGGGAGGG - Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1062116098 9:134809809-134809831 GTCAGAAATGTCCCCAGAGAGGG - Intronic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1185822862 X:3221395-3221417 ATAAAAAATGTAGCCAGACATGG - Intergenic
1185866605 X:3629807-3629829 GTCAAAAAATTAGCCAGACATGG - Intronic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186608110 X:11112042-11112064 GTCAACACTGTTTCCAGCCATGG + Exonic
1187339979 X:18412323-18412345 ATCCAAAATGCCTCCAGACAAGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188269853 X:28125581-28125603 TTTAAAAATGTGTCCATACAGGG - Intergenic
1188745293 X:33833884-33833906 GTCAAAAATGAGTTCAGCCAGGG + Intergenic
1188817635 X:34735004-34735026 GTCAAAACTGACTTCAGATATGG + Intergenic
1188993548 X:36853755-36853777 GAAAAAAATGACTCTAGACATGG - Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1194613397 X:96071921-96071943 ATCAAAATTATCTCCAGAAAGGG - Intergenic
1195630094 X:107046661-107046683 GCCAAAAATATCTCTAGACATGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1197529040 X:127600206-127600228 GTTAGAATTGTCGCCAGACACGG + Intergenic
1198204419 X:134452521-134452543 GGCAAAAATGTTTTGAGACAGGG - Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1200978272 Y:9236851-9236873 CTCAAAAATGTATACAGAAATGG + Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic