ID: 1002463853

View in Genome Browser
Species Human (GRCh38)
Location 5:179393923-179393945
Sequence TCTTCCAAGCAAGCTCCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002463848_1002463853 22 Left 1002463848 5:179393878-179393900 CCAAGCTGTCAGCCTGCATGTGC No data
Right 1002463853 5:179393923-179393945 TCTTCCAAGCAAGCTCCTTTTGG No data
1002463850_1002463853 10 Left 1002463850 5:179393890-179393912 CCTGCATGTGCTCTCATATGGAA No data
Right 1002463853 5:179393923-179393945 TCTTCCAAGCAAGCTCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002463853 Original CRISPR TCTTCCAAGCAAGCTCCTTT TGG Intergenic
No off target data available for this crispr