ID: 1002467616

View in Genome Browser
Species Human (GRCh38)
Location 5:179415516-179415538
Sequence CAGTTTTCACTGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002467607_1002467616 9 Left 1002467607 5:179415484-179415506 CCCCAGGAGCTTCTGGAGGTGGG No data
Right 1002467616 5:179415516-179415538 CAGTTTTCACTGAATGAGGAAGG No data
1002467611_1002467616 7 Left 1002467611 5:179415486-179415508 CCAGGAGCTTCTGGAGGTGGGGT No data
Right 1002467616 5:179415516-179415538 CAGTTTTCACTGAATGAGGAAGG No data
1002467602_1002467616 16 Left 1002467602 5:179415477-179415499 CCCTATTCCCCAGGAGCTTCTGG No data
Right 1002467616 5:179415516-179415538 CAGTTTTCACTGAATGAGGAAGG No data
1002467604_1002467616 15 Left 1002467604 5:179415478-179415500 CCTATTCCCCAGGAGCTTCTGGA No data
Right 1002467616 5:179415516-179415538 CAGTTTTCACTGAATGAGGAAGG No data
1002467609_1002467616 8 Left 1002467609 5:179415485-179415507 CCCAGGAGCTTCTGGAGGTGGGG No data
Right 1002467616 5:179415516-179415538 CAGTTTTCACTGAATGAGGAAGG No data
1002467601_1002467616 19 Left 1002467601 5:179415474-179415496 CCTCCCTATTCCCCAGGAGCTTC No data
Right 1002467616 5:179415516-179415538 CAGTTTTCACTGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002467616 Original CRISPR CAGTTTTCACTGAATGAGGA AGG Intergenic
No off target data available for this crispr