ID: 1002468953

View in Genome Browser
Species Human (GRCh38)
Location 5:179423210-179423232
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002468953_1002468958 9 Left 1002468953 5:179423210-179423232 CCTGCAGGAGTCTCCTCAGCAGG No data
Right 1002468958 5:179423242-179423264 TACAGCAATCCAGAGTGGCCAGG No data
1002468953_1002468961 19 Left 1002468953 5:179423210-179423232 CCTGCAGGAGTCTCCTCAGCAGG No data
Right 1002468961 5:179423252-179423274 CAGAGTGGCCAGGTCGGTGAAGG No data
1002468953_1002468959 13 Left 1002468953 5:179423210-179423232 CCTGCAGGAGTCTCCTCAGCAGG No data
Right 1002468959 5:179423246-179423268 GCAATCCAGAGTGGCCAGGTCGG No data
1002468953_1002468957 4 Left 1002468953 5:179423210-179423232 CCTGCAGGAGTCTCCTCAGCAGG No data
Right 1002468957 5:179423237-179423259 AGCATTACAGCAATCCAGAGTGG No data
1002468953_1002468962 20 Left 1002468953 5:179423210-179423232 CCTGCAGGAGTCTCCTCAGCAGG No data
Right 1002468962 5:179423253-179423275 AGAGTGGCCAGGTCGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002468953 Original CRISPR CCTGCTGAGGAGACTCCTGC AGG (reversed) Intergenic
No off target data available for this crispr