ID: 1002468961

View in Genome Browser
Species Human (GRCh38)
Location 5:179423252-179423274
Sequence CAGAGTGGCCAGGTCGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002468953_1002468961 19 Left 1002468953 5:179423210-179423232 CCTGCAGGAGTCTCCTCAGCAGG No data
Right 1002468961 5:179423252-179423274 CAGAGTGGCCAGGTCGGTGAAGG No data
1002468956_1002468961 6 Left 1002468956 5:179423223-179423245 CCTCAGCAGGAAGGAGCATTACA No data
Right 1002468961 5:179423252-179423274 CAGAGTGGCCAGGTCGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002468961 Original CRISPR CAGAGTGGCCAGGTCGGTGA AGG Intergenic
No off target data available for this crispr