ID: 1002470028

View in Genome Browser
Species Human (GRCh38)
Location 5:179429642-179429664
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002470028_1002470041 30 Left 1002470028 5:179429642-179429664 CCCTGCCTCATCTATACAGGCTG No data
Right 1002470041 5:179429695-179429717 TCTACACGGGCTGTCCACACTGG No data
1002470028_1002470036 17 Left 1002470028 5:179429642-179429664 CCCTGCCTCATCTATACAGGCTG No data
Right 1002470036 5:179429682-179429704 ATCCAACACCCCATCTACACGGG No data
1002470028_1002470035 16 Left 1002470028 5:179429642-179429664 CCCTGCCTCATCTATACAGGCTG No data
Right 1002470035 5:179429681-179429703 CATCCAACACCCCATCTACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002470028 Original CRISPR CAGCCTGTATAGATGAGGCA GGG (reversed) Intergenic
No off target data available for this crispr