ID: 1002470060

View in Genome Browser
Species Human (GRCh38)
Location 5:179429814-179429836
Sequence CAGCCTGTATAGATGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002470060_1002470067 16 Left 1002470060 5:179429814-179429836 CCCTGCCTCATCTATACAGGCTG No data
Right 1002470067 5:179429853-179429875 CATCCAACACCCCATCTACACGG No data
1002470060_1002470073 30 Left 1002470060 5:179429814-179429836 CCCTGCCTCATCTATACAGGCTG No data
Right 1002470073 5:179429867-179429889 TCTACACGGGCTGTCCACACTGG No data
1002470060_1002470068 17 Left 1002470060 5:179429814-179429836 CCCTGCCTCATCTATACAGGCTG No data
Right 1002470068 5:179429854-179429876 ATCCAACACCCCATCTACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002470060 Original CRISPR CAGCCTGTATAGATGAGGCA GGG (reversed) Intergenic
No off target data available for this crispr