ID: 1002470067

View in Genome Browser
Species Human (GRCh38)
Location 5:179429853-179429875
Sequence CATCCAACACCCCATCTACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002470065_1002470067 -8 Left 1002470065 5:179429838-179429860 CCACCATGGGAGCGTCATCCAAC No data
Right 1002470067 5:179429853-179429875 CATCCAACACCCCATCTACACGG No data
1002470060_1002470067 16 Left 1002470060 5:179429814-179429836 CCCTGCCTCATCTATACAGGCTG No data
Right 1002470067 5:179429853-179429875 CATCCAACACCCCATCTACACGG No data
1002470062_1002470067 11 Left 1002470062 5:179429819-179429841 CCTCATCTATACAGGCTGTCCAC No data
Right 1002470067 5:179429853-179429875 CATCCAACACCCCATCTACACGG No data
1002470059_1002470067 17 Left 1002470059 5:179429813-179429835 CCCCTGCCTCATCTATACAGGCT No data
Right 1002470067 5:179429853-179429875 CATCCAACACCCCATCTACACGG No data
1002470061_1002470067 15 Left 1002470061 5:179429815-179429837 CCTGCCTCATCTATACAGGCTGT No data
Right 1002470067 5:179429853-179429875 CATCCAACACCCCATCTACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002470067 Original CRISPR CATCCAACACCCCATCTACA CGG Intergenic
No off target data available for this crispr