ID: 1002473436

View in Genome Browser
Species Human (GRCh38)
Location 5:179451058-179451080
Sequence GAGGTGTCCGGGGAACCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002473436_1002473446 11 Left 1002473436 5:179451058-179451080 CCGCCAGGTTCCCCGGACACCTC No data
Right 1002473446 5:179451092-179451114 CTTGCAATCATGTCATTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002473436 Original CRISPR GAGGTGTCCGGGGAACCTGG CGG (reversed) Intergenic
No off target data available for this crispr