ID: 1002473441

View in Genome Browser
Species Human (GRCh38)
Location 5:179451077-179451099
Sequence ATTGCAAGAAGAGGGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002473441_1002473446 -8 Left 1002473441 5:179451077-179451099 CCTCCATCCCCTCTTCTTGCAAT No data
Right 1002473446 5:179451092-179451114 CTTGCAATCATGTCATTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002473441 Original CRISPR ATTGCAAGAAGAGGGGATGG AGG (reversed) Intergenic
No off target data available for this crispr