ID: 1002473446

View in Genome Browser
Species Human (GRCh38)
Location 5:179451092-179451114
Sequence CTTGCAATCATGTCATTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002473439_1002473446 0 Left 1002473439 5:179451069-179451091 CCCGGACACCTCCATCCCCTCTT No data
Right 1002473446 5:179451092-179451114 CTTGCAATCATGTCATTGCATGG No data
1002473435_1002473446 17 Left 1002473435 5:179451052-179451074 CCTCTTCCGCCAGGTTCCCCGGA No data
Right 1002473446 5:179451092-179451114 CTTGCAATCATGTCATTGCATGG No data
1002473437_1002473446 8 Left 1002473437 5:179451061-179451083 CCAGGTTCCCCGGACACCTCCAT No data
Right 1002473446 5:179451092-179451114 CTTGCAATCATGTCATTGCATGG No data
1002473436_1002473446 11 Left 1002473436 5:179451058-179451080 CCGCCAGGTTCCCCGGACACCTC No data
Right 1002473446 5:179451092-179451114 CTTGCAATCATGTCATTGCATGG No data
1002473441_1002473446 -8 Left 1002473441 5:179451077-179451099 CCTCCATCCCCTCTTCTTGCAAT No data
Right 1002473446 5:179451092-179451114 CTTGCAATCATGTCATTGCATGG No data
1002473440_1002473446 -1 Left 1002473440 5:179451070-179451092 CCGGACACCTCCATCCCCTCTTC No data
Right 1002473446 5:179451092-179451114 CTTGCAATCATGTCATTGCATGG No data
1002473438_1002473446 1 Left 1002473438 5:179451068-179451090 CCCCGGACACCTCCATCCCCTCT No data
Right 1002473446 5:179451092-179451114 CTTGCAATCATGTCATTGCATGG No data
1002473433_1002473446 18 Left 1002473433 5:179451051-179451073 CCCTCTTCCGCCAGGTTCCCCGG No data
Right 1002473446 5:179451092-179451114 CTTGCAATCATGTCATTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002473446 Original CRISPR CTTGCAATCATGTCATTGCA TGG Intergenic
No off target data available for this crispr