ID: 1002475346

View in Genome Browser
Species Human (GRCh38)
Location 5:179461982-179462004
Sequence CGGTGCCAGGCATGGGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002475346_1002475354 -3 Left 1002475346 5:179461982-179462004 CCTCCACCCCATGCCTGGCACCG No data
Right 1002475354 5:179462002-179462024 CCGCCGTCCCGGTTCAGCCCTGG No data
1002475346_1002475360 23 Left 1002475346 5:179461982-179462004 CCTCCACCCCATGCCTGGCACCG No data
Right 1002475360 5:179462028-179462050 CAGCCGCATACTCCTGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002475346 Original CRISPR CGGTGCCAGGCATGGGGTGG AGG (reversed) Intergenic
No off target data available for this crispr