ID: 1002476472

View in Genome Browser
Species Human (GRCh38)
Location 5:179469210-179469232
Sequence AACGTGGCTTTCCCTACAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002476472_1002476479 -1 Left 1002476472 5:179469210-179469232 CCCGTTGTAGGGAAAGCCACGTT No data
Right 1002476479 5:179469232-179469254 TCTATCATGAAGTGGGGGCGAGG No data
1002476472_1002476483 9 Left 1002476472 5:179469210-179469232 CCCGTTGTAGGGAAAGCCACGTT No data
Right 1002476483 5:179469242-179469264 AGTGGGGGCGAGGCTGGGGATGG No data
1002476472_1002476482 5 Left 1002476472 5:179469210-179469232 CCCGTTGTAGGGAAAGCCACGTT No data
Right 1002476482 5:179469238-179469260 ATGAAGTGGGGGCGAGGCTGGGG No data
1002476472_1002476484 10 Left 1002476472 5:179469210-179469232 CCCGTTGTAGGGAAAGCCACGTT No data
Right 1002476484 5:179469243-179469265 GTGGGGGCGAGGCTGGGGATGGG No data
1002476472_1002476485 18 Left 1002476472 5:179469210-179469232 CCCGTTGTAGGGAAAGCCACGTT No data
Right 1002476485 5:179469251-179469273 GAGGCTGGGGATGGGAGCATAGG No data
1002476472_1002476475 -8 Left 1002476472 5:179469210-179469232 CCCGTTGTAGGGAAAGCCACGTT No data
Right 1002476475 5:179469225-179469247 GCCACGTTCTATCATGAAGTGGG No data
1002476472_1002476477 -7 Left 1002476472 5:179469210-179469232 CCCGTTGTAGGGAAAGCCACGTT No data
Right 1002476477 5:179469226-179469248 CCACGTTCTATCATGAAGTGGGG No data
1002476472_1002476478 -6 Left 1002476472 5:179469210-179469232 CCCGTTGTAGGGAAAGCCACGTT No data
Right 1002476478 5:179469227-179469249 CACGTTCTATCATGAAGTGGGGG No data
1002476472_1002476480 3 Left 1002476472 5:179469210-179469232 CCCGTTGTAGGGAAAGCCACGTT No data
Right 1002476480 5:179469236-179469258 TCATGAAGTGGGGGCGAGGCTGG No data
1002476472_1002476481 4 Left 1002476472 5:179469210-179469232 CCCGTTGTAGGGAAAGCCACGTT No data
Right 1002476481 5:179469237-179469259 CATGAAGTGGGGGCGAGGCTGGG No data
1002476472_1002476474 -9 Left 1002476472 5:179469210-179469232 CCCGTTGTAGGGAAAGCCACGTT No data
Right 1002476474 5:179469224-179469246 AGCCACGTTCTATCATGAAGTGG No data
1002476472_1002476486 19 Left 1002476472 5:179469210-179469232 CCCGTTGTAGGGAAAGCCACGTT No data
Right 1002476486 5:179469252-179469274 AGGCTGGGGATGGGAGCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002476472 Original CRISPR AACGTGGCTTTCCCTACAAC GGG (reversed) Intergenic
No off target data available for this crispr