ID: 1002483390

View in Genome Browser
Species Human (GRCh38)
Location 5:179517940-179517962
Sequence GGCCCCCGTGGACCAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002483390_1002483402 14 Left 1002483390 5:179517940-179517962 CCCTCTGCTGGTCCACGGGGGCC No data
Right 1002483402 5:179517977-179517999 GGTCTCCTGGGAGTCAGAGGGGG No data
1002483390_1002483396 1 Left 1002483390 5:179517940-179517962 CCCTCTGCTGGTCCACGGGGGCC No data
Right 1002483396 5:179517964-179517986 CTGCAGCTGGCCAGGTCTCCTGG No data
1002483390_1002483399 11 Left 1002483390 5:179517940-179517962 CCCTCTGCTGGTCCACGGGGGCC No data
Right 1002483399 5:179517974-179517996 CCAGGTCTCCTGGGAGTCAGAGG No data
1002483390_1002483394 -7 Left 1002483390 5:179517940-179517962 CCCTCTGCTGGTCCACGGGGGCC No data
Right 1002483394 5:179517956-179517978 GGGGGCCGCTGCAGCTGGCCAGG No data
1002483390_1002483405 21 Left 1002483390 5:179517940-179517962 CCCTCTGCTGGTCCACGGGGGCC No data
Right 1002483405 5:179517984-179518006 TGGGAGTCAGAGGGGGCCATGGG No data
1002483390_1002483401 13 Left 1002483390 5:179517940-179517962 CCCTCTGCTGGTCCACGGGGGCC No data
Right 1002483401 5:179517976-179517998 AGGTCTCCTGGGAGTCAGAGGGG No data
1002483390_1002483397 2 Left 1002483390 5:179517940-179517962 CCCTCTGCTGGTCCACGGGGGCC No data
Right 1002483397 5:179517965-179517987 TGCAGCTGGCCAGGTCTCCTGGG No data
1002483390_1002483404 20 Left 1002483390 5:179517940-179517962 CCCTCTGCTGGTCCACGGGGGCC No data
Right 1002483404 5:179517983-179518005 CTGGGAGTCAGAGGGGGCCATGG No data
1002483390_1002483400 12 Left 1002483390 5:179517940-179517962 CCCTCTGCTGGTCCACGGGGGCC No data
Right 1002483400 5:179517975-179517997 CAGGTCTCCTGGGAGTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002483390 Original CRISPR GGCCCCCGTGGACCAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr