ID: 1002484091

View in Genome Browser
Species Human (GRCh38)
Location 5:179523038-179523060
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 2, 1: 0, 2: 3, 3: 38, 4: 251}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002484082_1002484091 5 Left 1002484082 5:179523010-179523032 CCTTCCTGGGCAGGTGCCTCGGG No data
Right 1002484091 5:179523038-179523060 GCCTCTGTGTGAGGTGCTCTGGG 0: 2
1: 0
2: 3
3: 38
4: 251
1002484085_1002484091 1 Left 1002484085 5:179523014-179523036 CCTGGGCAGGTGCCTCGGGGCCC No data
Right 1002484091 5:179523038-179523060 GCCTCTGTGTGAGGTGCTCTGGG 0: 2
1: 0
2: 3
3: 38
4: 251
1002484076_1002484091 21 Left 1002484076 5:179522994-179523016 CCGGGCTCATCAGCCGCCTTCCT No data
Right 1002484091 5:179523038-179523060 GCCTCTGTGTGAGGTGCTCTGGG 0: 2
1: 0
2: 3
3: 38
4: 251
1002484080_1002484091 8 Left 1002484080 5:179523007-179523029 CCGCCTTCCTGGGCAGGTGCCTC No data
Right 1002484091 5:179523038-179523060 GCCTCTGTGTGAGGTGCTCTGGG 0: 2
1: 0
2: 3
3: 38
4: 251
1002484075_1002484091 22 Left 1002484075 5:179522993-179523015 CCCGGGCTCATCAGCCGCCTTCC No data
Right 1002484091 5:179523038-179523060 GCCTCTGTGTGAGGTGCTCTGGG 0: 2
1: 0
2: 3
3: 38
4: 251
1002484073_1002484091 29 Left 1002484073 5:179522986-179523008 CCCTGAGCCCGGGCTCATCAGCC No data
Right 1002484091 5:179523038-179523060 GCCTCTGTGTGAGGTGCTCTGGG 0: 2
1: 0
2: 3
3: 38
4: 251
1002484074_1002484091 28 Left 1002484074 5:179522987-179523009 CCTGAGCCCGGGCTCATCAGCCG No data
Right 1002484091 5:179523038-179523060 GCCTCTGTGTGAGGTGCTCTGGG 0: 2
1: 0
2: 3
3: 38
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002484091 Original CRISPR GCCTCTGTGTGAGGTGCTCT GGG Intergenic
900250943 1:1669198-1669220 CCCTCTGTGTGGGGGACTCTAGG + Intronic
900713837 1:4131660-4131682 ACCTATGTGTGAGGTGTCCTCGG + Intergenic
901060970 1:6471748-6471770 GCTGCTGTGTGAGGTGCGCTGGG - Exonic
902557674 1:17256547-17256569 GGCTCTGTGTGAGATGCTGGGGG - Intronic
902574681 1:17369977-17369999 GTCTCTGTTTTAGTTGCTCTTGG - Intergenic
902631648 1:17708205-17708227 GCCACTGTGTGCCGGGCTCTGGG + Intergenic
902685859 1:18077284-18077306 GCTTCAGTGTCATGTGCTCTGGG + Intergenic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
906066210 1:42982301-42982323 ACCTCTGTGTAATCTGCTCTTGG - Intergenic
906276819 1:44523085-44523107 GCATCTGTAAGAGGGGCTCTGGG + Intronic
907846982 1:58217811-58217833 GGCTCTGTGTTAGGTACTATGGG - Intronic
909042194 1:70668098-70668120 GCCTCTGTGTCAGCTGCTCAGGG - Intergenic
913168386 1:116210336-116210358 ACCTCTGTGTGGGGTGCCCTTGG - Intergenic
913489540 1:119366099-119366121 GCCTATGTGTGAAATGCTGTGGG - Intergenic
915106960 1:153540776-153540798 GTCTCTGTGTGCACTGCTCTGGG - Intronic
916080488 1:161229129-161229151 ACCTCTGAGTCAGGTGCCCTAGG + Exonic
916809602 1:168293814-168293836 GCCTGTCTGTGAGCTGCTTTGGG + Intronic
917261601 1:173175342-173175364 GCCACTGTGTTAGGTGTTCTGGG - Intergenic
919182366 1:194103233-194103255 GGCTCTCTGTGAGGTGTTTTTGG + Intergenic
920536274 1:206738638-206738660 TCCTCTCTGTGGGGTGCCCTTGG + Intergenic
920708842 1:208275793-208275815 GCTTCTGTCTGATGAGCTCTGGG + Intergenic
920949394 1:210558156-210558178 GGCTCTGTGTTAGGTGTTATGGG - Intronic
920979869 1:210823072-210823094 CTCTCTGTGTGAGCTGCTCCTGG + Intronic
921949064 1:220910153-220910175 GCCTCTGTGCCAGGTGCTGTGGG + Intergenic
923762904 1:236863327-236863349 GTCTGTCTTTGAGGTGCTCTTGG + Intronic
924146086 1:241076099-241076121 GCCTCTCTGTGGGGTCCTCCAGG - Intronic
1063149618 10:3324374-3324396 GAATCTGTGTGAGCTGCTCATGG + Intergenic
1067444360 10:46331406-46331428 GCCTCTGTGTGTAGGGCTTTGGG + Intergenic
1067979921 10:51073836-51073858 CCACCTGTGTGAGGCGCTCTGGG + Intronic
1067981857 10:51096234-51096256 GACTCTGTGTAATGAGCTCTTGG + Intronic
1070537322 10:77389504-77389526 TCCTCTGCTTGAGGAGCTCTTGG - Intronic
1072725180 10:97808298-97808320 GCCTCTGCCTGATGTGGTCTAGG + Intergenic
1072951765 10:99853054-99853076 GCCTTTGTGTCAGGTTCTTTTGG + Intergenic
1073344989 10:102776285-102776307 GCCTGTGTGTGCGGTGGTCCTGG - Intronic
1073825260 10:107313461-107313483 CCCTCTGGCTGAGGTGCTCTTGG + Intergenic
1077218494 11:1404984-1405006 GCCTCTGTCTCTGGTGGTCTAGG + Intronic
1077289831 11:1783874-1783896 GCCTGAGTGTGGGGTGCTGTGGG - Intergenic
1077487524 11:2845910-2845932 GCCTCCGTGGTAGGTGCTGTGGG + Intronic
1078016989 11:7623579-7623601 GCCTCTATGGGAGGTCCTGTAGG - Intronic
1078912693 11:15747771-15747793 TCCTCTGTCTGAGATGCTTTGGG - Intergenic
1079158171 11:17968138-17968160 GGCTCTGTGTTAGGTGCTGTGGG - Intronic
1080798793 11:35590085-35590107 GCACCTGTGTGTGGTCCTCTGGG - Intergenic
1080886801 11:36375557-36375579 GCCTATGTGTGATGTGCGATCGG + Intronic
1084259239 11:67963919-67963941 GCCTTTGTGTGGGGAGCTCAGGG + Intergenic
1084506119 11:69569638-69569660 GCCTGTGTGTGTGGCGCTCAGGG - Intergenic
1084922113 11:72479548-72479570 TGCTCTCTATGAGGTGCTCTAGG + Intergenic
1089303454 11:117512506-117512528 GCATGGGTGTGAGGGGCTCTGGG - Intronic
1089757237 11:120695902-120695924 GCCTCTGTGTGAGGGGTGCAAGG - Intronic
1090812446 11:130257693-130257715 CCCTCTGTGTGAGTTTCCCTGGG - Intronic
1091885153 12:4011656-4011678 ACCTCTGTTGGAGGAGCTCTAGG - Intergenic
1094480072 12:30874575-30874597 GCCTTTGTGTGGGCTGCCCTGGG + Intergenic
1095380090 12:41580587-41580609 GAATATTTGTGAGGTGCTCTGGG + Intergenic
1096881677 12:54678254-54678276 GGTGCTGTGTGAGGTTCTCTAGG + Intergenic
1097839958 12:64312074-64312096 GACTCTGGCTGAGGTGATCTAGG + Intronic
1098177750 12:67810532-67810554 GCCTCTGTTTGAGGCTCTATTGG + Intergenic
1098357784 12:69627440-69627462 GGCTCTGTGGGAGGAGCGCTAGG + Intergenic
1102172883 12:110855461-110855483 GCCTGTGTGTGGGGTGCTGTTGG - Intronic
1102496038 12:113320316-113320338 GGCTCTGGGTGAGCAGCTCTGGG - Exonic
1103512304 12:121483828-121483850 GCCTCAGTGTGAGGGGGCCTTGG - Intronic
1104885638 12:132105557-132105579 ACCTCTGTGGCAGGTGCTCACGG + Intronic
1104903637 12:132202235-132202257 GCAACTGAGTGAGGTGCTCCAGG - Intronic
1105535168 13:21259315-21259337 GCCACTGTGTGAGCTGCTACCGG + Intergenic
1105628281 13:22135288-22135310 GCCTCTGTGGAGGCTGCTCTGGG + Intergenic
1108591806 13:51919097-51919119 GCCTCTGTGTGAAGTGCCAGTGG + Intergenic
1112337117 13:98524941-98524963 GCCTCTGTGTCAGCAGCTGTAGG + Intronic
1113454924 13:110441582-110441604 GCCTCTGGGTGGGGTGCATTTGG - Intronic
1113546921 13:111159882-111159904 GCCTCTGTTTTCGGTGCTTTTGG + Intronic
1113784508 13:112995465-112995487 GCCGCTGTGTGAGCTGCTGCTGG + Intronic
1117747018 14:58879969-58879991 GGCCCTGTGTTAGGTGCTGTGGG - Intergenic
1119036349 14:71232856-71232878 GCCTCTGTGTGAGTTTTGCTCGG - Intergenic
1119853702 14:77884008-77884030 ACCTCCCTGTGGGGTGCTCTTGG + Intronic
1121535205 14:94686329-94686351 GCCTCTGCCTGAGGAGCCCTGGG + Intergenic
1122033476 14:98930848-98930870 ACCTCTGTGTGTGGAGCTCACGG - Intergenic
1122122160 14:99560461-99560483 GTCTCTGTGTGTGGTACTCATGG - Intronic
1122503598 14:102217917-102217939 GCCTCTGTGGCAGGTGCTCCTGG - Intronic
1122656177 14:103260831-103260853 GGCTGTGTGTGAGGTGCTGCAGG + Intergenic
1122856463 14:104562594-104562616 GCCTCTGTGTGAGGTGGATCAGG + Intronic
1123477237 15:20598620-20598642 TCCTCTGTGTGGGGTGATCTGGG - Intergenic
1123640776 15:22401744-22401766 TCCTCTGTGTGGGGTGATCTGGG + Intergenic
1124223004 15:27865955-27865977 GGCTCTTTGGGAGGTGATCTGGG - Intronic
1124593806 15:31077453-31077475 GCCTCTGTGTGAGATGTCCCTGG - Intronic
1125333879 15:38608376-38608398 GCCTCTGTGTGAGGTGTTTCTGG - Intergenic
1125896749 15:43308873-43308895 GCCTCTGTGTCAGGTGCTGAGGG + Intergenic
1125906483 15:43397629-43397651 ACTTCTATGTGAGGTTCTCTTGG - Intronic
1128391400 15:67185174-67185196 GGCTCTGTGCCAGGTGCTGTAGG + Intronic
1128780288 15:70354649-70354671 TCCTCTGTATGAGGCGCTCCGGG - Intergenic
1131541045 15:93275641-93275663 GTTTATGTGTGAGGTGCTCTGGG - Intergenic
1132385931 15:101399807-101399829 GCCTCTGAGTGGGGAGCTGTGGG - Intronic
1132591011 16:726491-726513 GCCCCTGTGGGCGGTGCCCTGGG - Intronic
1132613559 16:829334-829356 GCTTCTGTGTGGGGTGATGTGGG + Intergenic
1134100003 16:11445471-11445493 GGGTCTGTGTGAGGTGGTCTGGG + Intronic
1134174299 16:11993367-11993389 GCCTCTGTGTTTGCTGCCCTGGG - Intronic
1134201702 16:12204760-12204782 GCTGCTGTGTGATGTGCTCAGGG + Intronic
1137984820 16:53099025-53099047 CCCTCTGTGGGTAGTGCTCTGGG - Intronic
1138153567 16:54682162-54682184 GTCTTTGTGTGAGGGGCTGTCGG - Intergenic
1139358779 16:66383598-66383620 GGCCCTGTGTGAGTTGCTCAAGG - Intronic
1141304208 16:82845683-82845705 GCCCCTATATGAGGTACTCTTGG - Intronic
1141763568 16:86044515-86044537 GCGTATCTGGGAGGTGCTCTGGG - Intergenic
1141815585 16:86407503-86407525 GCCTCTGAGTGTGGTTCTCCAGG - Intergenic
1142195515 16:88737615-88737637 GCCTCGGTGTCGGGTGCTGTGGG + Exonic
1142531230 17:580944-580966 GGTTCTGTGGGAGGTTCTCTGGG - Intronic
1146610366 17:34299542-34299564 GCCTCTCTGTGAGTTGCTCTGGG - Intergenic
1148133214 17:45274668-45274690 GCCTCTGTGTGTGGAGCACTAGG - Intronic
1149517692 17:57292789-57292811 GCCTTTCTGTGAGTTGCTTTAGG + Intronic
1150318659 17:64191335-64191357 GCCTCTTTTGAAGGTGCTCTGGG + Intronic
1156047219 18:32890218-32890240 GCCTCTTTGGGAAGTCCTCTGGG + Intergenic
1156513794 18:37662839-37662861 CCCTGTGTGTGACATGCTCTTGG + Intergenic
1157485369 18:48083463-48083485 GCCTCTGTATGAGGAGGTGTGGG - Intronic
1157684641 18:49632280-49632302 CTCTCAGTGTGAGGTGCTTTCGG + Intergenic
1159232240 18:65623905-65623927 GACACTGTGTGTGATGCTCTTGG + Intergenic
1160157305 18:76443333-76443355 GCCTGTGTGTGAAGTGTTGTTGG - Intronic
1160493465 18:79356789-79356811 CCCTGTGTGAGGGGTGCTCTGGG + Intronic
1160493521 18:79357023-79357045 CCCTGTGTGAGGGGTGCTCTGGG + Intronic
1160493551 18:79357147-79357169 CCCTGTGTGAGGGGTGCTCTGGG + Intronic
1160493572 18:79357225-79357247 CCCTGTGTGAGGGGTGCTCTGGG + Intronic
1160493592 18:79357303-79357325 CCCTGTGTGAGGGGTGCTCTGGG + Intronic
1160493686 18:79357661-79357683 CCCTGTGTGAGGGGTGCTCTGGG + Intronic
1160493716 18:79357785-79357807 CCCTGTGTGAGGGGTGCTCTGGG + Intronic
1160493737 18:79357863-79357885 CCCTGTGTGAGGGGTGCTCTGGG + Intronic
1160493831 18:79358221-79358243 CCCTGTGTGAGGGGTGCTCTGGG + Intronic
1160493885 18:79358409-79358431 GTCTGTGTGAGGGGTGCTCTGGG + Intronic
1160493896 18:79358455-79358477 CCCTGTGTGAGGGGTGCTCTGGG + Intronic
1160493945 18:79358657-79358679 CCCTGTGTGAGGGGTGCTCTGGG + Intronic
1160493985 18:79358813-79358835 CCCTGTGTGAGGGGTGCTCTGGG + Intronic
1160494014 18:79358937-79358959 CCCTGTGTGAGGGGTGCTCTGGG + Intronic
1161039754 19:2103910-2103932 GCATCTGGGTGATGTGATCTTGG - Intronic
1161774445 19:6251636-6251658 GCCACTGTGCCAGGTCCTCTAGG - Intronic
1162418999 19:10555198-10555220 GCCCCTGTGTTGGGTGCTCTGGG + Intronic
1164707169 19:30328417-30328439 GCCTCTGTGTAACCTGCTCTTGG + Intronic
1164714130 19:30379271-30379293 GCCTCTGTGTTGGGAGCTCCCGG + Intronic
1164812134 19:31165574-31165596 GCCTGTGGGTGAGCTGCACTCGG - Intergenic
1165015041 19:32874715-32874737 GCGTCTGTGCTGGGTGCTCTGGG - Intergenic
1167153033 19:47720673-47720695 GCCTGTGTGTGAGATGGTCTAGG + Intronic
925308590 2:2866188-2866210 GCCTCTGTCTGGGGTGGTGTGGG + Intergenic
925395393 2:3529827-3529849 TCCTCTGTGTATGGTGCCCTGGG + Intergenic
925797529 2:7563116-7563138 GGCTCTGTGTTAGGTGCTATGGG - Intergenic
929449440 2:42027034-42027056 GCCCCTGAGTGAGGTCTTCTAGG - Intergenic
929781375 2:44959388-44959410 GGCTTTGTGTTAGGTGCTGTGGG - Intergenic
933278249 2:80304779-80304801 GCCCATGTCTGAGGTGCTCGGGG - Intronic
933701628 2:85259125-85259147 GCCACTGTGTGTGGTGCTGTGGG - Intronic
935209031 2:100922648-100922670 GTGTCTGTGTGTGGTGGTCTCGG + Intronic
935674419 2:105581887-105581909 TCCTCTTTGTCAGGTGCTATGGG - Intergenic
937303658 2:120858050-120858072 GCCTCTGTGTAGGGTGGTCGAGG + Intronic
937359702 2:121220230-121220252 AGCTCTGTGTAAGGGGCTCTGGG + Exonic
937855879 2:126671755-126671777 GCCAAAGTGTGAGGTCCTCTTGG - Intronic
938916630 2:135947522-135947544 GGTTCTGTGTGAAGTGCTTTAGG + Intronic
940145589 2:150542260-150542282 GCCCCTGTGTGAGATCCACTGGG - Intergenic
941603872 2:167571541-167571563 CCCTCTGTGTGAGGTGCTATGGG - Intergenic
942497415 2:176554179-176554201 GGCTCTGAGTGAGGAGCTCTGGG - Intergenic
944900251 2:204206615-204206637 GCCTCTGTCTGAGATGATATGGG - Intergenic
944934761 2:204556266-204556288 GTCTCTGTGTGATGTTTTCTAGG + Intronic
948469088 2:238165964-238165986 GCCTCAGGATGAGGTGCTCAGGG - Intronic
949011154 2:241679320-241679342 GGCTCTGTGGGAGGTTCTCGTGG - Intronic
1169981907 20:11394187-11394209 GTCTTTGTGTGAGGTGAACTTGG + Intergenic
1171447654 20:25216303-25216325 GCCTCCGCCTGAGATGCTCTGGG + Intronic
1172245704 20:33443744-33443766 GCCGCTGGGGGAGGAGCTCTGGG + Exonic
1174375992 20:50127097-50127119 ACCTCTGTGGGAGGCACTCTAGG - Intronic
1174773495 20:53322884-53322906 GCCTCTGTGTTTGGTGCTCATGG + Intronic
1175153164 20:56951219-56951241 GCCTGAGTGCGAGGTGCTCTGGG + Intergenic
1176301207 21:5099974-5099996 GCCTGTGTGTCAGGTGCCCATGG - Intergenic
1178752413 21:35317372-35317394 GCCTCTCTGTGCAGTGTTCTTGG + Intronic
1179249788 21:39663299-39663321 GCCTCTGTGTGACTGGCTTTGGG + Exonic
1179346248 21:40560279-40560301 GCCTCTGTCTGAGCTTCTCTAGG - Intronic
1179855822 21:44161924-44161946 GCCTGTGTGTCAGGTGCCCATGG + Intergenic
1181636213 22:24176031-24176053 GCATCTGTGTCAGGTCCTATGGG - Intronic
1184138344 22:42562482-42562504 GCTTGTGTGTGAGGTTCTCTGGG + Intronic
951574780 3:24102479-24102501 GGCACTGTGTTAGGTGCTGTAGG - Intergenic
951793091 3:26508158-26508180 GCCTGTGAGTGAGGTCGTCTTGG - Intergenic
953711412 3:45274190-45274212 GCCTCTATGAGAGGGGCTGTGGG - Intergenic
954603519 3:51891317-51891339 ACCTCTGTGGGTGGTCCTCTGGG + Intergenic
954716815 3:52531104-52531126 GCCTCTGAGGCAAGTGCTCTGGG - Intronic
956555165 3:70513546-70513568 TCCTGTGTGTGAGGCACTCTTGG + Intergenic
959336002 3:105066175-105066197 GCCTCAGGCTGAAGTGCTCTGGG + Intergenic
962234169 3:133693599-133693621 GCCTCAGTGTCAGGTGCTACTGG + Intergenic
962961007 3:140310902-140310924 GCCTCTGTGTTAGGTGCTGCAGG + Intronic
964620354 3:158715053-158715075 TGCTCTGTGTGCAGTGCTCTCGG - Intronic
966330727 3:178810112-178810134 GGCTCTGTTTAAGGTGTTCTTGG + Intronic
966389488 3:179437212-179437234 GACTCTGTGGGTGCTGCTCTGGG - Intronic
966861969 3:184235549-184235571 GTCTATGTGTGAGAGGCTCTTGG - Intronic
967749230 3:193094885-193094907 GCCTCTGTGTGGGGTGGGGTGGG - Intergenic
968596580 4:1489151-1489173 GCCTCTGCAGGAGCTGCTCTGGG - Intergenic
968675225 4:1874314-1874336 GCCTTTGTGTGGGCTGTTCTTGG + Intronic
968713080 4:2134812-2134834 TTCTATGTGTGAGGTGCTCCTGG - Intronic
968819004 4:2836213-2836235 ACGTCTGTGTGAGCTGCTCTAGG + Exonic
969255523 4:5999204-5999226 GGCTATGTCTGATGTGCTCTGGG - Intergenic
973012234 4:45091362-45091384 GCCTCTGCCTGAGATGTTCTAGG + Intergenic
979060915 4:116059364-116059386 GCCTCAGGATGTGGTGCTCTGGG - Intergenic
980893780 4:138841560-138841582 GCCTCTGTGTTAGGTGCCCCAGG - Intergenic
981114012 4:140968771-140968793 GCCTCTTGGTGAGGAGTTCTGGG + Intronic
981212900 4:142129898-142129920 TCTTCTATGTGAGGTGCTGTGGG + Intronic
982590109 4:157298087-157298109 GCCTTTATGTGATGTGCTTTAGG + Intronic
984331149 4:178320461-178320483 GTCTCTGTGTGAGTTTCTTTGGG - Intergenic
985328615 4:188801495-188801517 GCCTCTGAGCCAGGTTCTCTGGG + Intergenic
985542379 5:492889-492911 GCCCCTGGGTGGGGTGTTCTAGG + Intronic
987814637 5:22884420-22884442 AGCTCTCTGTGAGGTCCTCTTGG - Intergenic
988500998 5:31783701-31783723 GCCTCAGAGGGAGGTGCTATAGG - Intronic
988537770 5:32084244-32084266 GCCTCTGTGTGGAGAGCCCTTGG - Intronic
989116141 5:37954793-37954815 GCATCTGAGTTAGATGCTCTTGG + Intergenic
995232494 5:109784369-109784391 GTCTATGTGTGTGTTGCTCTTGG + Intronic
995518214 5:112975045-112975067 GCCTGTGAGGGAGGTGATCTTGG - Intergenic
997216440 5:132114991-132115013 GCCTCTGTCCTAGGTGCTATGGG - Intergenic
997587176 5:135050357-135050379 GGCTCTGTGAGATGTGCTCGCGG - Intronic
997638857 5:135435456-135435478 GCCCCTGGGTGAGGTGCACGGGG - Intergenic
1000506087 5:162119999-162120021 GCCTCTGTCTGAGAGGCACTAGG - Intronic
1001114267 5:168925728-168925750 TCCTGAGGGTGAGGTGCTCTAGG + Intronic
1001322406 5:170693402-170693424 TCCTCTGTGTGCCATGCTCTGGG + Intronic
1002484091 5:179523038-179523060 GCCTCTGTGTGAGGTGCTCTGGG + Intergenic
1002500474 5:179644443-179644465 GCCTCTGTGTGAGGTGCTCTGGG - Intronic
1004024186 6:11803254-11803276 GCCTGTGTGGGTGGTGCTGTGGG - Intronic
1004484899 6:16057270-16057292 GCCACTGTGGAAGGTGCTATAGG - Intergenic
1004556664 6:16705099-16705121 GCTTCTGTGTGAACTGCTGTGGG - Intronic
1005444240 6:25904714-25904736 GGCTCTGGGTGAGATGCTATAGG - Intergenic
1007718049 6:43868778-43868800 GCCTCTGTATCAGGTGCTAGAGG - Intergenic
1014294610 6:119603488-119603510 GCCTCTGTTTGGGGAGCTCATGG + Intergenic
1015177235 6:130323308-130323330 GCTTCCCTGTGAGATGCTCTTGG + Intronic
1015433602 6:133159421-133159443 GACTCTGTGTGAGAAGCTCTGGG - Intergenic
1015971275 6:138744856-138744878 ACCTCTGTGTGAGTTTCTTTGGG - Intergenic
1018580109 6:165301263-165301285 GCCTCTGGGCGCAGTGCTCTGGG - Intronic
1018707830 6:166475799-166475821 GCCCCCGTGTGAGTTGCTCCAGG - Intronic
1022334147 7:29406720-29406742 GCCACTGTGTGGGGGACTCTGGG + Intronic
1023393427 7:39731751-39731773 GCCTCTGTGTGTGGGTCCCTAGG + Intergenic
1023760272 7:43459156-43459178 GGCTCTGTGTGAGGGATTCTGGG - Intronic
1023892400 7:44402641-44402663 CCCTCTGAGCGAGGAGCTCTTGG - Intronic
1032413607 7:131719206-131719228 GCCTCTGTATGGGAAGCTCTGGG - Intergenic
1033539740 7:142345486-142345508 GCCTCTGACTGGGGTCCTCTGGG - Intergenic
1034449653 7:151130463-151130485 GCCCCAGAGGGAGGTGCTCTTGG - Intronic
1034498377 7:151435227-151435249 GAACCTGTGTGAGGGGCTCTTGG + Intronic
1034562400 7:151889536-151889558 GCCTCTGTGTGCGCTGGCCTTGG + Intergenic
1035501842 8:95541-95563 CCCTGTGTGTGATGTGTTCTCGG + Intergenic
1035501891 8:96052-96074 CCCTGTGTGTGATGTGTTCTCGG + Intergenic
1035649139 8:1251650-1251672 GCCTCTGTGTCAGGTCATGTTGG + Intergenic
1036510146 8:9392523-9392545 GCTTCTGCCTGAGGTGGTCTGGG - Intergenic
1040276934 8:46018610-46018632 GCCTCTGTGTGGGGTCCACTGGG - Intergenic
1041005098 8:53490128-53490150 CCCTCTGTGAGAGCTTCTCTAGG + Intergenic
1041518820 8:58732325-58732347 GCCTCTCTGTGAGCTCCTCTAGG - Intergenic
1041746282 8:61212132-61212154 GCCTCTGTGTGAGTTTCTTATGG - Intronic
1045218921 8:100178027-100178049 GCCTATGTGTGATGTCCTCTAGG + Intronic
1046183732 8:110686276-110686298 GCCACTGTGCTAGGTGCTGTGGG + Intergenic
1046348865 8:112977562-112977584 GCCTGTGAGTGAGGGGCTCCAGG - Intronic
1047493413 8:125392041-125392063 GGGTGTGTGGGAGGTGCTCTTGG - Intergenic
1048574763 8:135681756-135681778 GCCTCTGGGTGATGTGGTGTCGG + Intergenic
1048632244 8:136256832-136256854 GCCTCTTGGTGAGGAGGTCTAGG - Intergenic
1048698666 8:137058700-137058722 GCCTCAGTGTGAGGTTATGTTGG - Intergenic
1049037799 8:140090320-140090342 GCTTCTGTGGGAGCTGCTCATGG - Intronic
1049338818 8:142100962-142100984 GCCTCTGGGACAGGTGCTTTTGG + Intergenic
1049346987 8:142144333-142144355 GGCCCTGTGTGACGAGCTCTGGG + Intergenic
1049744592 8:144257873-144257895 GCCTAAGTGTGAGGTGCTCGAGG + Intronic
1049760188 8:144328660-144328682 GCCCATGTGTGAGGGGCTCTTGG - Intergenic
1050480358 9:6081504-6081526 GCCTCTGAGTGAACTGCTCAGGG + Intergenic
1051728638 9:20114810-20114832 GCCTCTCTGTAAGATGCTGTAGG + Intergenic
1053450845 9:38192818-38192840 GCATCTGTGGGAGGTGGGCTTGG + Intergenic
1053575713 9:39356283-39356305 TCCCCTGTGTGGGGTGATCTGGG + Intronic
1053840233 9:42184240-42184262 TCCCCTGTGTGGGGTGATCTGGG + Intronic
1054097283 9:60914988-60915010 TCCCCTGTGTGGGGTGATCTGGG + Intergenic
1054118689 9:61190617-61190639 TCCCCTGTGTGGGGTGATCTGGG + Intronic
1054589068 9:66991947-66991969 TCCCCTGTGTGGGGTGATCTGGG - Intergenic
1055371883 9:75608439-75608461 GCTGGTGTGTGAGCTGCTCTAGG - Intergenic
1055987076 9:82063059-82063081 TCCTCTGTGTGGGGTGATATTGG - Intergenic
1056572573 9:87828575-87828597 TCCTCTGTGTGTGTTCCTCTGGG - Intergenic
1056705713 9:88951157-88951179 GCCTCTGGGAGATGGGCTCTGGG + Intergenic
1056846669 9:90044188-90044210 GCATCTGTGTCATGTGCTCTGGG - Intergenic
1056952566 9:91055161-91055183 GCATCTGTTTGAGTTTCTCTAGG + Intergenic
1057160104 9:92883178-92883200 TCCTCTGTGTGGGGTGATATGGG + Intergenic
1057171459 9:92965611-92965633 GCCTCTGTGTGCAGGGCACTCGG - Intronic
1059453171 9:114383476-114383498 GCCTTTGTGTGAGCTGCTCTGGG - Intronic
1059964969 9:119604501-119604523 CCCTATGTGCTAGGTGCTCTGGG + Intergenic
1061031133 9:128083957-128083979 GTCTTTGTGTGTGGTGCTCCAGG + Intronic
1061475251 9:130861051-130861073 GCCTCTGAGTGAACTGCTCTAGG - Intronic
1062472292 9:136712002-136712024 GCCTCCGCGTGGGGTGCTCGGGG - Intergenic
1203606617 Un_KI270748v1:63412-63434 CCCTGTGTGTGATGTGTTCTCGG - Intergenic
1203606625 Un_KI270748v1:63513-63535 CCCTGTGTGTGATGTGTTCTCGG - Intergenic
1203606660 Un_KI270748v1:63918-63940 CCCTGTGTGTGATGTGTTCTCGG - Intergenic
1203606668 Un_KI270748v1:64019-64041 CCCTGTGTGTGATGTGTTCTCGG - Intergenic
1203606705 Un_KI270748v1:64426-64448 CCCTGTGTGTGATGTGTTCTCGG - Intergenic
1203606792 Un_KI270748v1:65347-65369 CCCTGTGTGTGATGTGTTCTCGG - Intergenic
1203606829 Un_KI270748v1:65754-65776 CCCTGTGTGTGATGTGTTCTCGG - Intergenic
1203606837 Un_KI270748v1:65855-65877 CCCTGTGTGTGATGTGTTCTCGG - Intergenic
1203606874 Un_KI270748v1:66262-66284 CCCTGTGTGTGATGTGTTCTCGG - Intergenic
1203606974 Un_KI270748v1:67327-67349 CCCTGTGTGTGATGTGTTCTCGG - Intergenic
1187010056 X:15269679-15269701 GGCTCTGTGTGAGGTGTCCATGG - Intronic
1187069244 X:15871778-15871800 GCTTGTGTGTTAGGTGCTTTGGG - Intergenic
1187143478 X:16616540-16616562 GCCTCTAGGTTAGGTGCTCTGGG - Intronic
1187575459 X:20549480-20549502 GCCTCTGTGCCAGGTGCACCAGG - Intergenic
1189149328 X:38688189-38688211 GCCTCGGGGTGAGGTTCACTAGG - Exonic
1189266101 X:39717278-39717300 GCTCCTGGGTGAGCTGCTCTAGG - Intergenic
1190286926 X:48967486-48967508 GCCTCTGTCTTACCTGCTCTAGG + Intronic
1190744524 X:53314327-53314349 GGTTCTGTGTTAGGTGCTGTGGG - Intronic
1192744291 X:73923419-73923441 TCCTCTGTGTGAGGAGCTGCCGG + Intergenic
1197820814 X:130539040-130539062 GCATCTGTGAAAAGTGCTCTGGG + Intergenic
1200114485 X:153764241-153764263 GGCTCTGTGAGACGTGCTCCTGG + Exonic
1201329447 Y:12802270-12802292 GCCTCTTTGTGATGTGGTTTGGG - Intronic
1201800797 Y:17953074-17953096 GCCTCTTTGTGATTTGCTTTGGG + Intergenic
1202360575 Y:24105592-24105614 GCCTCTTTGTGATTTGCTTTGGG + Intergenic
1202510203 Y:25564526-25564548 GCCTCTTTGTGATTTGCTTTGGG - Intergenic