ID: 1002484496

View in Genome Browser
Species Human (GRCh38)
Location 5:179524833-179524855
Sequence CACCCACCAGGTGTGTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002484496_1002484500 3 Left 1002484496 5:179524833-179524855 CCTGTCCACACACCTGGTGGGTG No data
Right 1002484500 5:179524859-179524881 TCTAGCCCTCGAGTGATCCGAGG No data
1002484496_1002484503 9 Left 1002484496 5:179524833-179524855 CCTGTCCACACACCTGGTGGGTG No data
Right 1002484503 5:179524865-179524887 CCTCGAGTGATCCGAGGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002484496 Original CRISPR CACCCACCAGGTGTGTGGAC AGG (reversed) Intergenic
No off target data available for this crispr