ID: 1002492130

View in Genome Browser
Species Human (GRCh38)
Location 5:179586180-179586202
Sequence GGCACACGGCATCATGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002492130_1002492141 15 Left 1002492130 5:179586180-179586202 CCCTTCCCATGATGCCGTGTGCC 0: 1
1: 0
2: 1
3: 11
4: 136
Right 1002492141 5:179586218-179586240 AAAGCACAGACTCTGTCATAAGG 0: 1
1: 0
2: 1
3: 19
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002492130 Original CRISPR GGCACACGGCATCATGGGAA GGG (reversed) Intronic
900550194 1:3250701-3250723 GGCTCAGGGCAGCCTGGGAAAGG + Intronic
902161054 1:14530641-14530663 GGCACATTGCATCGTGAGAAAGG - Intergenic
902622814 1:17660273-17660295 GGCAGATGGCATAATGGGTAAGG + Intronic
906160807 1:43647798-43647820 GGGACAGGGAATGATGGGAAAGG - Intergenic
907609087 1:55849805-55849827 GGCAGAAGGCAGCCTGGGAAAGG + Intergenic
907911826 1:58833873-58833895 GGCAGACAGCATCAGGGGCAAGG + Intergenic
911314589 1:96340662-96340684 GGCACAGGGAATCATGTGAGGGG - Intergenic
912020066 1:105097114-105097136 GGCTCATGGAATCATGGGAGTGG + Intergenic
919110568 1:193214295-193214317 GGTACACTGCATTATTGGAACGG - Intronic
921128953 1:212202799-212202821 GGCCCAGGGCATGCTGGGAAGGG + Intergenic
923231760 1:231993285-231993307 GGCTGAGGGCATCTTGGGAAAGG + Intronic
1067729214 10:48797086-48797108 GGCACAGGGCATCTGGGGAGTGG + Intronic
1075234424 10:120713680-120713702 GGCACACAGCTGCCTGGGAAGGG + Intergenic
1078216920 11:9319343-9319365 GAAATACGGCCTCATGGGAAGGG - Intergenic
1081014513 11:37859297-37859319 GACATACGGCCTCATGGGAAGGG + Intergenic
1081625458 11:44652700-44652722 AGCACAGGGCATCCTGGGGATGG + Intergenic
1083758244 11:64802660-64802682 AGCACAAAGCATCATGGGGAAGG + Intronic
1084547421 11:69821359-69821381 GGCACACGGCAACCTGGCAGTGG - Intergenic
1084557522 11:69883793-69883815 GGCACTCAGCATCACTGGAAAGG - Intergenic
1084780977 11:71407942-71407964 TGCACACGGCATCCTGGAAGTGG - Intergenic
1085053667 11:73392270-73392292 GAGACACGGCAGCCTGGGAACGG + Exonic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1091228708 11:133974010-133974032 GGCTCACGCAATCATCGGAAGGG - Intergenic
1091681229 12:2528584-2528606 GGCACATGGCATGATGGGTAGGG - Intronic
1101859708 12:108473115-108473137 AGCAGACGGCATCTTGGCAATGG + Intergenic
1102140891 12:110614095-110614117 GGCGCGGGGCATCACGGGAAGGG - Intronic
1105809823 13:23985324-23985346 CACACAGGGAATCATGGGAAAGG + Intronic
1106036112 13:26046891-26046913 GGCACTGGGGATCATGGGGATGG + Exonic
1106625999 13:31421568-31421590 GACAGACAGCATCATGGGGATGG + Intergenic
1111370771 13:87313660-87313682 GGCACAAGTCATGATGAGAATGG - Intergenic
1119298526 14:73552612-73552634 GGCACAGGGGATTGTGGGAATGG - Intronic
1119302823 14:73584799-73584821 GGCACAGGGGATTGTGGGAATGG - Intergenic
1120741129 14:88110168-88110190 GACACATGGCATCATGGGAATGG - Intergenic
1121612349 14:95290198-95290220 GACCCAGGGCATCATGGTAAGGG - Intronic
1122046110 14:99025197-99025219 GGCACACACCATCCTGGGATGGG + Intergenic
1122804102 14:104248024-104248046 GGAGCAGGGCATCATGGGCAGGG + Intergenic
1124619882 15:31267518-31267540 GGCAGGCGGCAGCATGGGAGTGG - Intergenic
1124674767 15:31674766-31674788 GGAAAAAGGCATCATGAGAAAGG - Intronic
1124840799 15:33240521-33240543 GACCCACTGCATCCTGGGAAAGG + Intergenic
1125323035 15:38509024-38509046 GCCACAGTGCATGATGGGAATGG - Intronic
1125922229 15:43531814-43531836 GGCAGAAGGCCTCCTGGGAAGGG + Intergenic
1126167970 15:45669664-45669686 GGCAGAGGGCATGATGGGAGTGG + Intronic
1130461687 15:84164018-84164040 GAGATACGGCCTCATGGGAAGGG - Intergenic
1132932255 16:2464670-2464692 GGCCGAGGGCAGCATGGGAAAGG - Exonic
1136251982 16:29011436-29011458 GGCACAAGGGATCATTGGAGTGG + Intergenic
1137252348 16:46749335-46749357 GGCACACGGCCTCCTGAGGATGG + Intronic
1138933746 16:61694159-61694181 GCCACACTGCATCTTGGCAAAGG + Intronic
1139839571 16:69867689-69867711 GACACACCGCATCCTGAGAAGGG + Intronic
1140986814 16:80165727-80165749 GGCACACAAGATCCTGGGAAAGG - Intergenic
1143927284 17:10383105-10383127 GTCCCAGGGCATCATGGGAAGGG + Intergenic
1147790705 17:43012959-43012981 GGCACTCAGCATCAATGGAATGG + Intronic
1151142156 17:72003979-72004001 GGCACTCAGCACCATGGGCAGGG - Intergenic
1158638262 18:59180082-59180104 GTCAGACGGCCTCATAGGAAAGG + Intergenic
1161087440 19:2341525-2341547 GGCACTCGGCCTCATGGGGGAGG - Intronic
1163820688 19:19494826-19494848 GGCCCACGGCAGGATGGGCATGG - Intronic
1165395945 19:35563620-35563642 GGCACCGGGCACCATGGGGAAGG - Exonic
1167004826 19:46768741-46768763 GGGATATGGCCTCATGGGAAGGG + Intronic
1168645013 19:58054033-58054055 GGCCCACGGCCACATGTGAATGG + Exonic
926762213 2:16288060-16288082 GGCACTCACCATCATTGGAAAGG + Intergenic
928023334 2:27720911-27720933 GGGACACGGAATGTTGGGAAGGG + Intergenic
931272822 2:60717744-60717766 GGCACAGGGCATGGTGGGTAAGG - Intergenic
933634920 2:84698376-84698398 GGGACACAGAATCATTGGAAGGG + Intronic
933916275 2:86997021-86997043 AGCACAGGGTATCATGGAAATGG - Intronic
934006718 2:87772881-87772903 AGCACAGGGTATCATGGAAATGG + Intronic
935419334 2:102851138-102851160 GGCAGAAGGCAGGATGGGAAAGG - Intergenic
935770368 2:106413804-106413826 AGCACAGGGTATCATGGAAATGG + Intronic
935967843 2:108499014-108499036 AGCACAGGGTATCATGGAAATGG - Intronic
936131503 2:109847269-109847291 AGCACAGGGTATCATGGAAATGG - Intronic
936213194 2:110524216-110524238 AGCACAGGGTATCATGGAAATGG + Intronic
936422333 2:112378773-112378795 AGCACAGGGTATCATGGAAATGG + Intronic
942727189 2:179023012-179023034 GGCACACAGCATGCTGGGTATGG + Intronic
943717944 2:191172901-191172923 AGCTCACGGTATAATGGGAAAGG + Intergenic
947796029 2:232894527-232894549 GGCACAGGTGCTCATGGGAAGGG + Intronic
947797118 2:232901658-232901680 GGCACACGGGTGGATGGGAAGGG - Intronic
948546328 2:238731737-238731759 GGCACAATGCATGCTGGGAACGG + Intergenic
1168907317 20:1416722-1416744 GGCACAGAGTACCATGGGAAAGG - Intergenic
1169549258 20:6685355-6685377 GTCTCACGGCATCATGGGCCTGG - Intergenic
1170552130 20:17487231-17487253 GGCACACCCCATCTTGGGATGGG - Intergenic
1170552139 20:17487259-17487281 GGCACACCCCATCTTGGGATGGG - Intergenic
1174194144 20:48761151-48761173 AGGACACAGCATCATGGGCAGGG + Intronic
1174418749 20:50385474-50385496 GGCACATGCCCTCATGGGACAGG + Intergenic
1175344254 20:58260495-58260517 GGTACATGGAATCCTGGGAAGGG - Intergenic
1175712894 20:61235247-61235269 AGCCCACGGCAGCAGGGGAAGGG + Intergenic
1179967639 21:44816747-44816769 GGCACACCCCAGCATGGCAATGG + Intronic
1180172973 21:46070080-46070102 GGAGCACGGCACCCTGGGAAAGG + Intergenic
1182065428 22:27428253-27428275 GGAACACTGAATGATGGGAAGGG - Intergenic
1182522235 22:30891148-30891170 GGCACACGGCCTCCTGGAGATGG + Intronic
1183628660 22:39020386-39020408 GGAACACGCTACCATGGGAAGGG + Intronic
1184818069 22:46887149-46887171 GGCAGATGGCCTCATGGGAAGGG + Intronic
949611726 3:5709855-5709877 GGAAAACGGCTTCATGGGCAGGG - Intergenic
950424824 3:12919451-12919473 GGCACCCGCCACCAGGGGAAGGG + Intronic
951657774 3:25028596-25028618 GGGAGAAGGAATCATGGGAAAGG + Intergenic
951832212 3:26943125-26943147 GGGACAGAGCATCAGGGGAAGGG + Intergenic
952849996 3:37719954-37719976 GGCAGAGGGCATCATGAGGAAGG + Intronic
957474886 3:80709965-80709987 GGGACACAGCACCAGGGGAAGGG + Intergenic
959008811 3:101050501-101050523 CCCACACGGCATCGTGGCAAGGG + Intergenic
959501114 3:107106983-107107005 GGAACATGACATCATGGAAATGG - Intergenic
959791488 3:110367417-110367439 GACATATGGCCTCATGGGAAGGG + Intergenic
960462497 3:117953261-117953283 GGCAAAAGGCATCAGGGCAATGG - Intergenic
964052638 3:152415074-152415096 GGCACCAGGCATCATGGCATTGG - Exonic
966533252 3:181004113-181004135 GGGACAGAGCATCAGGGGAAGGG - Intergenic
966862290 3:184237130-184237152 GGCAGATGGCATCAGGGGAAGGG + Intronic
969092644 4:4706713-4706735 GGCACAGGGCAGCATGGCAGAGG + Intergenic
969689658 4:8697324-8697346 AGCTCACGACATCATGGAAAGGG - Intergenic
976215914 4:82715370-82715392 GGCACAGAGCAGCATGAGAAGGG - Intronic
985504718 5:272111-272133 CGCACTCTGCATCTTGGGAAGGG - Intronic
985743396 5:1633485-1633507 CGCACTCTGCATCTTGGGAAGGG + Intergenic
987354890 5:17054820-17054842 GACACACAGCATCCTGGGAACGG + Intergenic
992108043 5:73466603-73466625 AGCTCAGGCCATCATGGGAAGGG - Intergenic
995740060 5:115346940-115346962 GAGACATGGCCTCATGGGAAGGG + Intergenic
997439159 5:133897143-133897165 GGCACAGGCCATCATGGGGTAGG - Intergenic
998063081 5:139134432-139134454 GGCCCACTCCATCATTGGAATGG + Intronic
1000687589 5:164272054-164272076 GGTACACAGCATGATGAGAAAGG + Intergenic
1002378763 5:178809232-178809254 GGCTCAAGGCAGCATGGCAAGGG + Intergenic
1002492130 5:179586180-179586202 GGCACACGGCATCATGGGAAGGG - Intronic
1006394149 6:33776121-33776143 GGCACATAGCTTCATGGGAAGGG - Intronic
1008592622 6:53009355-53009377 GGCACAAGGAGTCATGGGACGGG - Intronic
1009995719 6:70893076-70893098 GTCACATGGCATCGTGGGAGAGG - Intronic
1010337671 6:74705611-74705633 TGAATACTGCATCATGGGAAAGG - Intergenic
1014269629 6:119322117-119322139 GGCACAAAGGAACATGGGAATGG - Intronic
1015331391 6:131983548-131983570 GGCACAGGGCACCATGGCAAAGG + Intergenic
1018017651 6:159727057-159727079 GCCCCAGGGCATCACGGGAAGGG - Exonic
1018956695 6:168415232-168415254 GACACACGGCAGCATGGAGACGG + Intergenic
1020766600 7:12329636-12329658 GGTTCAGGACATCATGGGAATGG - Intergenic
1022488716 7:30800365-30800387 TGCACATGTCATGATGGGAAAGG - Intronic
1022498308 7:30866802-30866824 GGCAGAAGGCAGCTTGGGAAGGG + Intronic
1026367809 7:69667106-69667128 GGCACAGGGCATCATGTGCAAGG + Intronic
1027167412 7:75845167-75845189 AGTACAGGCCATCATGGGAAGGG - Intronic
1028630224 7:92926293-92926315 GGCACAGAGCACCTTGGGAAAGG - Intergenic
1032512307 7:132481668-132481690 GGCACCCAGCATCTTAGGAAGGG - Intronic
1033926793 7:146471552-146471574 GGCACAAGGCCACATGGAAATGG - Intronic
1034817015 7:154181322-154181344 GTGACAAGGCATCATGGGAGAGG + Intronic
1035592259 8:824917-824939 GCCACAGGGCATCAGGGGATAGG + Intergenic
1039044098 8:33434593-33434615 GGCACGAGTGATCATGGGAAGGG - Intronic
1039893198 8:41698085-41698107 GGCACAGGGAATCCTGGGGATGG + Exonic
1044358737 8:91257044-91257066 GTGACATGTCATCATGGGAAGGG - Intronic
1045080848 8:98624246-98624268 GGAACACAGCAAAATGGGAAAGG + Intronic
1047895180 8:129358664-129358686 GGTACATGGCAGCATGGGGAGGG - Intergenic
1047911596 8:129535844-129535866 TGCACACGGAATCCTCGGAATGG - Intergenic
1051517908 9:17951181-17951203 GGCACAGGGCATCATGGAGAGGG + Intergenic
1058947234 9:109869223-109869245 GGCACCCAGGATCATGAGAAGGG - Intronic
1061033875 9:128102774-128102796 AACAGACAGCATCATGGGAAGGG - Intronic
1061499606 9:130994237-130994259 GGCAGACAGCAGCATGTGAAAGG - Intergenic
1061696614 9:132380550-132380572 GGCGCACAGCATTATGGGAAGGG - Intronic
1061918589 9:133769930-133769952 GCCACACGGAATCAGGGGCAGGG - Intronic
1185963093 X:4567273-4567295 GACACTCAGCATCATTGGAATGG - Intergenic
1187865220 X:23717571-23717593 GGCAAAAGGCTGCATGGGAAAGG + Intronic
1200079103 X:153566751-153566773 GGCAGAGGGCATGATTGGAAAGG - Intronic
1201005072 Y:9504576-9504598 GCCATGGGGCATCATGGGAAAGG - Intergenic