ID: 1002493798

View in Genome Browser
Species Human (GRCh38)
Location 5:179598508-179598530
Sequence CTGGTTCCTGCTCTTTCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 692
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 634}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002493792_1002493798 19 Left 1002493792 5:179598466-179598488 CCTGCGTAAGTGTCAAGTGTGTG 0: 1
1: 0
2: 1
3: 6
4: 61
Right 1002493798 5:179598508-179598530 CTGGTTCCTGCTCTTTCTTGTGG 0: 1
1: 0
2: 3
3: 54
4: 634
1002493791_1002493798 20 Left 1002493791 5:179598465-179598487 CCCTGCGTAAGTGTCAAGTGTGT 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1002493798 5:179598508-179598530 CTGGTTCCTGCTCTTTCTTGTGG 0: 1
1: 0
2: 3
3: 54
4: 634
1002493790_1002493798 21 Left 1002493790 5:179598464-179598486 CCCCTGCGTAAGTGTCAAGTGTG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1002493798 5:179598508-179598530 CTGGTTCCTGCTCTTTCTTGTGG 0: 1
1: 0
2: 3
3: 54
4: 634
1002493789_1002493798 27 Left 1002493789 5:179598458-179598480 CCTTCTCCCCTGCGTAAGTGTCA 0: 1
1: 0
2: 0
3: 14
4: 102
Right 1002493798 5:179598508-179598530 CTGGTTCCTGCTCTTTCTTGTGG 0: 1
1: 0
2: 3
3: 54
4: 634
1002493794_1002493798 -4 Left 1002493794 5:179598489-179598511 CCTGCAGGCTTTTCTCTCCCTGG 0: 1
1: 0
2: 4
3: 31
4: 328
Right 1002493798 5:179598508-179598530 CTGGTTCCTGCTCTTTCTTGTGG 0: 1
1: 0
2: 3
3: 54
4: 634

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002493798 Original CRISPR CTGGTTCCTGCTCTTTCTTG TGG Intronic
900281522 1:1872651-1872673 CTGGTTCCTTCTCATCCTTCAGG + Intronic
901793856 1:11669067-11669089 TTGGTTCCTTCTCATTCTTCAGG + Intronic
902091204 1:13904605-13904627 CTGGTTCCTGCTGTTGCTGTTGG + Intergenic
902285073 1:15402794-15402816 CTGGTTCCTGGACTTCCTTGAGG - Intergenic
902718968 1:18291670-18291692 CTGGCTCCTACTCTTCCTTCAGG + Intronic
902757865 1:18560961-18560983 CTGTTTCCTGCTCTGTATGGAGG - Intergenic
902797085 1:18807013-18807035 CTGGCTCCTGCTCATGCTTTAGG - Intergenic
902807204 1:18868533-18868555 CTGGCTTCTCCTCTTTCCTGGGG + Intronic
903544880 1:24117833-24117855 CTGGTTCCAGCTCTATCTGCAGG + Intergenic
903948813 1:26981720-26981742 CTGGTTCCTGCTCATCTTTCAGG + Intergenic
903994032 1:27294015-27294037 CTGCTTCATGCTCTTTCTGGTGG - Exonic
904377060 1:30088311-30088333 CTGGTCCCTGCTCCTTCTGCAGG + Intergenic
904382554 1:30121147-30121169 TTGGGTCCTGCTCTTTCTGCAGG - Intergenic
906699421 1:47847111-47847133 CTGGAAACTGCTCCTTCTTGGGG + Intronic
906734397 1:48110687-48110709 CTGGTTCCTTCTCTTTGTTCAGG - Intergenic
907071537 1:51540133-51540155 CTGGATCCTTCTCATTCTTTAGG + Intergenic
907454746 1:54568079-54568101 CCGGTCCCTGCGCTTCCTTGGGG + Intronic
907794538 1:57702043-57702065 CTGTTTGCTGCCATTTCTTGAGG + Intronic
908568715 1:65386297-65386319 CTGGCACCTGCTCTTTATTATGG - Intronic
908818655 1:68059257-68059279 CTGGTTCTTTCTCATCCTTGTGG - Intergenic
908933759 1:69348366-69348388 CTGGTTCCTTCTAATTCTGGAGG + Intergenic
909368380 1:74855991-74856013 ATCTTTCCTGCTCTTTCTTGTGG + Intergenic
910074994 1:83266498-83266520 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
910217242 1:84854849-84854871 CTAGTTCCTGCTTCTTCTAGTGG - Intronic
910789210 1:91033797-91033819 CAGGTTCCTCCTTTTTATTGTGG + Intergenic
910816848 1:91299817-91299839 ATCTTTCCTGCTTTTTCTTGTGG - Intronic
911106562 1:94137134-94137156 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
911670398 1:100601347-100601369 CTCTTTCCTGCTTTTTCTTGTGG + Intergenic
912456845 1:109803753-109803775 CTAATTCCTGCTCTTTTTTCTGG + Intergenic
912731299 1:112108757-112108779 CTGTTTGCTGCTGTTTCTTGTGG + Intergenic
912867873 1:113275231-113275253 CCAGTTCCTGCTCATTCTTTGGG - Intergenic
912886281 1:113478342-113478364 CTGGTTTCTCCTCATTTTTGTGG + Intronic
912896666 1:113599102-113599124 CTCTTTCCTGCTTTCTCTTGTGG - Intronic
913118211 1:115716007-115716029 CTGTTTCCTGATCTGTCTAGTGG + Intronic
914822804 1:151118034-151118056 CTGCTTCCTGCTCTTTCTTTAGG - Exonic
915072466 1:153282075-153282097 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
915761445 1:158317771-158317793 ATGTTTCCTGCTTTCTCTTGTGG + Intergenic
916468409 1:165095261-165095283 CTGTTTCCTGTTATTTCCTGTGG - Intergenic
916543581 1:165781149-165781171 CTCTTTCCTGCTTTCTCTTGTGG + Intronic
916719772 1:167475563-167475585 ATGTGTCCTGCTCTTTCTTTTGG - Intronic
917063938 1:171071206-171071228 ATGGTTCCTTCTCTTTCTGATGG - Intergenic
917406686 1:174714074-174714096 CTTTTTCCTGCTCTTTGTAGTGG + Intronic
917582288 1:176391424-176391446 TGGGTGCCTGCTCTTTCTTCTGG + Intergenic
917919137 1:179735327-179735349 CTGATTTCTGCCTTTTCTTGGGG - Intergenic
918700439 1:187600565-187600587 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
918836373 1:189471845-189471867 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
919623022 1:199884057-199884079 ATCGTTCCTGCTTTCTCTTGTGG + Intergenic
921143428 1:212328116-212328138 TTGGTTCCTGCTTTTAGTTGAGG + Intronic
921241401 1:213187728-213187750 CTGTTTGCTGTTGTTTCTTGTGG + Intronic
921942134 1:220853319-220853341 CTGTTTGCTGGTGTTTCTTGTGG + Intergenic
923064534 1:230505732-230505754 GTGGATCCTGCACTATCTTGCGG - Intergenic
923591763 1:235327060-235327082 CTGGTTGCGGCTCTTTCTTCGGG - Intronic
923801841 1:237217803-237217825 CAAGTCTCTGCTCTTTCTTGGGG - Intronic
923835288 1:237604454-237604476 ATCTTTCCTGCTCTCTCTTGTGG - Intronic
924002457 1:239568809-239568831 CTTGTCCCTGTTCTTCCTTGGGG - Intronic
924026973 1:239843716-239843738 CTGCTTCTTCCTCTTTCTGGGGG - Intronic
924587376 1:245371762-245371784 CAGGTTCCTGGTCTTTCTGGAGG - Intronic
924955843 1:248925842-248925864 CAGGATCCTGCTCTTTCCTTTGG + Intergenic
1062810712 10:462062-462084 ATCTTTCCTGCTTTTTCTTGTGG - Intronic
1063006091 10:1971929-1971951 CTGGTTCTTCTGCTTTCTTGTGG + Intergenic
1063337047 10:5225708-5225730 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1063354225 10:5382799-5382821 CAGGTTCCTCCTCTTACTTTCGG - Intergenic
1063354544 10:5385921-5385943 CAGGTTCCTCCTCTTACTTTCGG + Intergenic
1063562260 10:7139822-7139844 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1063855700 10:10251122-10251144 CTGGTTCCGAGTCATTCTTGTGG - Intergenic
1064919270 10:20498735-20498757 GTCTTTCCTGCTTTTTCTTGTGG + Intergenic
1065595053 10:27302262-27302284 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1065787938 10:29233832-29233854 CTGCTTCCTGCTCTCTCTCTGGG - Intergenic
1065985796 10:30950281-30950303 ATGTTTCCTGCTTTCTCTTGTGG - Intronic
1066450411 10:35523111-35523133 CTGGTTCCTGGACTTTCTGTTGG - Intronic
1066750405 10:38650102-38650124 TTGATTCGTACTCTTTCTTGAGG + Intergenic
1066952560 10:42135497-42135519 CATGTTCCTTATCTTTCTTGTGG + Intergenic
1067181521 10:43990142-43990164 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
1067191895 10:44077867-44077889 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
1067977090 10:51038655-51038677 CTGGATCTTGCTCTTTTTTATGG + Intronic
1069284345 10:66693994-66694016 ATGTTTCCTGCTTTCTCTTGTGG - Intronic
1069366833 10:67702659-67702681 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1070007443 10:72438431-72438453 ATCGTTCCTGCTTTCTCTTGTGG - Intronic
1070455587 10:76611556-76611578 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1071054253 10:81490758-81490780 CTTGTTGCTGCTCATTCTTTGGG + Intergenic
1071190365 10:83092222-83092244 CTCTTTCCTGCTTTCTCTTGCGG - Intergenic
1071386753 10:85128766-85128788 ATCGTTCCTGCTTTCTCTTGTGG - Intergenic
1072210391 10:93240937-93240959 CTGATTTCTGCTCATTGTTGTGG - Intergenic
1072266547 10:93733709-93733731 CTGTTTGCTGTTGTTTCTTGTGG - Intergenic
1072772054 10:98150333-98150355 CTGTTTGCTGTTGTTTCTTGTGG + Intronic
1073078125 10:100837211-100837233 CTGATTCAGGCTCTTGCTTGTGG + Intergenic
1074000776 10:109370265-109370287 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
1074186141 10:111100920-111100942 CTGGTTCCTCCTCTTTTTCTTGG - Intergenic
1074470632 10:113723414-113723436 CCAGCTCCTGCTGTTTCTTGGGG + Intronic
1074483121 10:113846051-113846073 CTGGTTCCAGCCCATTCCTGTGG + Intronic
1074656147 10:115589833-115589855 TGGGCTCCTGATCTTTCTTGTGG - Intronic
1075800284 10:125149517-125149539 TTGGATTCTGCTCTGTCTTGTGG - Intronic
1075897113 10:126006282-126006304 CTGGTTCCTGCTGCTGCTTTTGG + Intronic
1076665784 10:132090813-132090835 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
1076665791 10:132090887-132090909 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
1076739822 10:132477651-132477673 CTGGCTCCTGTTCTCTCCTGGGG - Intergenic
1077020423 11:414823-414845 CTGGTTCCAGTTCTTTCCTCCGG + Exonic
1077035299 11:491543-491565 CTGGCACCTGCTCTCTCTGGGGG - Intergenic
1077121032 11:908615-908637 CTGGCTCCTTCTCTGTCTTCTGG + Intronic
1077683138 11:4265386-4265408 ATCGTTCCTGCTTTCTCTTGTGG - Intergenic
1078516502 11:12027226-12027248 CTGGTTCCTGCCCCTTCCAGAGG + Intergenic
1078640087 11:13086413-13086435 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1078981433 11:16539352-16539374 ATGTTTCCTGCTTTCTCTTGTGG - Intronic
1080118220 11:28644304-28644326 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1080449189 11:32364608-32364630 CTGGCTGCAGCTCTGTCTTGGGG + Intergenic
1081560993 11:44216384-44216406 CAGATTCCTTCACTTTCTTGCGG + Intronic
1081590445 11:44419251-44419273 TTGGTTTCTTCTCTGTCTTGAGG - Intergenic
1082734818 11:56844815-56844837 CTGATTCCTGCTCTTTCTCCTGG + Intergenic
1083003396 11:59318574-59318596 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
1083176494 11:60952997-60953019 CTGGCTGCTTCTCTTTATTGAGG + Intergenic
1083524284 11:63347518-63347540 ATGTTTCCTGCTTTCTCTTGTGG + Intronic
1084707135 11:70822106-70822128 GTGGTTTCTGCTGTTTCCTGCGG - Intronic
1085066387 11:73499136-73499158 TGGGTTCCTGCTCCTTCTTCTGG - Intronic
1085303226 11:75470973-75470995 GTGGTTCCAGCTCTTCTTTGAGG + Intronic
1085462107 11:76700442-76700464 CTGGTTACTGCTCTTTAATCCGG - Intergenic
1085694444 11:78692042-78692064 CAGGTCCCTGCTCTTTGTTGTGG - Intronic
1086480019 11:87224544-87224566 CTGGTTCTTATTCTTACTTGAGG + Intronic
1087313731 11:96581241-96581263 CTGGTTACTGCTATTTCTTAGGG - Intergenic
1088411686 11:109541198-109541220 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1089193125 11:116669752-116669774 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1090216033 11:124965749-124965771 ATCTTTCCTGCTTTTTCTTGTGG + Intronic
1090664990 11:128909015-128909037 CTGCTTCCTGCTCCTTCATGTGG - Intronic
1090723262 11:129496517-129496539 GTGTTTCCTGCTTTCTCTTGTGG - Intergenic
1092052442 12:5481179-5481201 CCGGTTCCTGCCCTTGCTGGAGG + Intronic
1093992794 12:25609433-25609455 CTGGTTTCTCCTCTTCTTTGTGG + Intronic
1094471726 12:30807796-30807818 CTGATTGCTGTTGTTTCTTGTGG - Intergenic
1094816053 12:34186061-34186083 CTGCTTGGTGCTCTATCTTGTGG + Intergenic
1095134262 12:38579496-38579518 CTGGATCTTGCTCTTTTTTATGG - Intergenic
1095798746 12:46249368-46249390 CTCTTTCCTGCTTTCTCTTGTGG - Intronic
1095827225 12:46543050-46543072 CTGTTTCCTGCTTTCTCTTGTGG + Intergenic
1095830697 12:46583408-46583430 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
1095899021 12:47308115-47308137 CTGTTTGCTGTTGTTTCTTGTGG - Intergenic
1097013814 12:55971355-55971377 CTGGTTCCTGCTCTCCCTGTTGG + Intronic
1097823657 12:64153107-64153129 CTGGTTCCTTCTCATTATTCAGG - Exonic
1098577724 12:72062795-72062817 CTGCTTACTGCCCTTCCTTGGGG - Intronic
1098621256 12:72602498-72602520 TTGTTTCCTGCTCTTCCATGTGG - Intronic
1099492348 12:83302767-83302789 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1099789715 12:87317719-87317741 CTAGTTTCTTCTGTTTCTTGTGG - Intergenic
1099800879 12:87454937-87454959 CTGTTTACTGTTGTTTCTTGTGG - Intergenic
1101374352 12:104157887-104157909 CTGGTTCCAACTCTGTCATGAGG + Intergenic
1101718978 12:107334770-107334792 CTGGTTCCTCCTCTTCCATCTGG - Intronic
1101738753 12:107483418-107483440 TTGGTCCCTGCTCTTCCCTGGGG + Intronic
1102918455 12:116773429-116773451 CTGGTCCCTGCCCTTTCTCGAGG - Intronic
1104263907 12:127212592-127212614 CTGCTTCCTTCTGTTTCCTGAGG - Intergenic
1104603923 12:130173590-130173612 CTGGTTCCTGCTGGTGCATGAGG - Intergenic
1104774179 12:131382490-131382512 CTGATTCCTGCTCCCTCCTGGGG + Intergenic
1104774196 12:131382545-131382567 CTGATTCCTGCTCCCTCCTGGGG + Intergenic
1104774213 12:131382600-131382622 CTGATTCCTGCTCCCTCCTGGGG + Intergenic
1104774231 12:131382656-131382678 CTGATTCCTGCTCCCTCCTGGGG + Intergenic
1104774248 12:131382714-131382736 CTGATTCCTGCTCCCTCCTGGGG + Intergenic
1104774266 12:131382768-131382790 CTGATTCCTGCTCCCTCCTGGGG + Intergenic
1104774314 12:131382939-131382961 CTGATTCCTGCTCCCTCCTGGGG + Intergenic
1104774331 12:131382994-131383016 CTGATTCCTGCTCCCTCCTGGGG + Intergenic
1104774346 12:131383049-131383071 CTGATTCCTGCTCCCTCCTGAGG + Intergenic
1104774362 12:131383105-131383127 CTGATTCCTGCTCCCTCCTGCGG + Intergenic
1104774379 12:131383163-131383185 CTGATTCCTGCTCCCTCCTGGGG + Intergenic
1104774397 12:131383219-131383241 CTGATTCCTGCTCCCTCCTGGGG + Intergenic
1104774442 12:131383387-131383409 CTGATTCCTGCTCCCTCCTGGGG + Intergenic
1104774474 12:131383501-131383523 CTGATTCCTGCTCCCTCCTGGGG + Intergenic
1104968476 12:132520525-132520547 CTGCATCCTGCTCTGTTTTGTGG - Intronic
1105073013 12:133247956-133247978 ATCGTTCCTGCTTTCTCTTGTGG - Intergenic
1105408569 13:20151237-20151259 CTGAGTCCTGCTCTTGCCTGAGG - Intronic
1105598079 13:21858834-21858856 ATCGTTCCTGCTTTCTCTTGTGG + Intergenic
1106754896 13:32812795-32812817 CTGCTCTCTGCCCTTTCTTGTGG + Intergenic
1106914307 13:34495982-34496004 ATCTTTCCTGCTTTTTCTTGGGG - Intergenic
1106959875 13:34986143-34986165 ATGTTTCCTGCTTTCTCTTGTGG + Intronic
1106974247 13:35187957-35187979 CTGGTACCTACTCATTCTTCAGG + Intronic
1107769120 13:43771224-43771246 AAGGTTCCTGCTCTTTCTGGAGG - Intronic
1107882011 13:44840988-44841010 CTGGTTCTTGATCATTCTTTAGG + Intergenic
1108230647 13:48336790-48336812 ATGTTTCCTGCTTTCTCTTGTGG + Intronic
1108475390 13:50811288-50811310 CTGGTTACTTCTCTTTCTAAAGG - Intronic
1108865778 13:54920753-54920775 ATGTTTCCTGCTTTATCTTGTGG - Intergenic
1109621414 13:64911799-64911821 CTGGTTCCTTCTCATATTTGTGG - Intergenic
1109967022 13:69713910-69713932 CTGCTTTCTCCTCTGTCTTGGGG - Intronic
1110258252 13:73456087-73456109 ATGTTTCCTGCTTTCTCTTGTGG + Intergenic
1110698161 13:78516316-78516338 ATGTTTCCTGCTTTCTCTTGTGG + Intergenic
1112217499 13:97448626-97448648 CTAGATCCAGCTCTCTCTTGTGG + Intronic
1112233298 13:97610665-97610687 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1112978834 13:105355787-105355809 CTGGTAGCATCTCTTTCTTGTGG - Intergenic
1113902848 13:113806239-113806261 CTGGTTCCTGCTCCCTCCTCGGG - Intronic
1113988687 13:114340974-114340996 CAGGATCCTGCTCTTTCCTGTGG + Intergenic
1114245929 14:20913611-20913633 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1114531524 14:23399472-23399494 GTGGTTCTTGATTTTTCTTGGGG + Intronic
1115015983 14:28614782-28614804 CTAATTCCTGCTCATTCTTTAGG + Intergenic
1115866891 14:37757793-37757815 ATTGTTCCTGCTTTCTCTTGTGG + Intronic
1116236219 14:42282727-42282749 ATGTTTCCTGCTTTCTCTTGTGG + Intergenic
1116336813 14:43666759-43666781 CTGGTTCTTGCTCATGTTTGTGG - Intergenic
1116339332 14:43701537-43701559 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1116402133 14:44520996-44521018 CTGTTTGCTGTTGTTTCTTGAGG + Intergenic
1117557679 14:56902644-56902666 CTTGTTCCTGCAGTTGCTTGGGG - Intergenic
1117822625 14:59666473-59666495 ATCTTTCCTGCTTTTTCTTGTGG - Intronic
1118484732 14:66203490-66203512 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1118569337 14:67177186-67177208 ATCTTTCCTGCTTTTTCTTGTGG + Intronic
1118958394 14:70504325-70504347 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
1119423072 14:74519335-74519357 GTGGTTGCTGCTTTTTCCTGGGG - Intronic
1120723711 14:87915690-87915712 CTGGTTCTTTCTCATTGTTGTGG + Intronic
1121644667 14:95509562-95509584 CTGTTTCCTGCTCTTTAAAGAGG - Intergenic
1122059939 14:99130258-99130280 CTGGGCACTGCTCTTTCTTGGGG - Intergenic
1122816073 14:104314735-104314757 CTGGCTCCTGCTCTCTTCTGTGG + Intergenic
1123116732 14:105898265-105898287 CTGTTGCCTGGTGTTTCTTGGGG + Intergenic
1123123027 14:105926857-105926879 CTGGGTCCTGGTCCTTCATGAGG + Intronic
1123216171 14:106811054-106811076 CTGGGTCCTGCTCTTTCTTCAGG - Intergenic
1124030997 15:26011825-26011847 TTGGTTTCTTCTCTTTCTTTTGG + Intergenic
1124733758 15:32224724-32224746 CTGGTTGTAGCTCTTTTTTGGGG + Intergenic
1125214856 15:37259936-37259958 CTCCTGCCTGCTCTTTCTTCTGG + Intergenic
1125570742 15:40715940-40715962 CTGGTTCCAAGTCTTTCTTTAGG + Intronic
1126506030 15:49405853-49405875 CTGGTTCTTTCTCATTTTTGTGG + Intronic
1126585155 15:50278694-50278716 CTGCTTCCTGTTCTTTCTTTAGG + Exonic
1126884123 15:53131220-53131242 CTGGTTCCTGCTCCCTCAGGGGG - Intergenic
1126884824 15:53138555-53138577 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
1127739890 15:61892596-61892618 CTGCTTGCTGTTGTTTCTTGTGG - Intronic
1128440865 15:67707213-67707235 CTGGTTCTTGTTTTTTCTTAAGG + Intronic
1128503010 15:68242040-68242062 CTGTTTCCTGTTATTTCTTGTGG - Intronic
1128867181 15:71123034-71123056 CTAGTTACTGTTCTTTCCTGAGG + Intronic
1130095581 15:80853339-80853361 CTGGTTCCAGTCCCTTCTTGCGG - Intronic
1130172998 15:81536052-81536074 CTGTTTGCTGTTGTTTCTTGTGG - Intergenic
1131262786 15:90896834-90896856 CTATTTCCTGAACTTTCTTGAGG - Intergenic
1132725992 16:1338615-1338637 CTGGGTCCTGCTCAGTCCTGCGG - Exonic
1132920129 16:2384686-2384708 CTTGTTCCTGATCTTTGTGGGGG + Intergenic
1132923656 16:2415218-2415240 CTGTTTGCTGCTCTTTTCTGGGG - Intergenic
1133230741 16:4365408-4365430 CGAGTTCCTCCTCTCTCTTGGGG + Intronic
1133593673 16:7270197-7270219 CAGGTTCCTGCTCCTGCCTGGGG - Intronic
1135475636 16:22772142-22772164 CTGGCTCCTGCAATTTCTTGAGG - Intergenic
1135666295 16:24338203-24338225 CTGGCTCCTTCTCTTTTTTCAGG + Intronic
1136316237 16:29455931-29455953 TCGGATCCAGCTCTTTCTTGAGG + Intronic
1136430814 16:30195273-30195295 TCGGATCCAGCTCTTTCTTGAGG + Intronic
1136499090 16:30660712-30660734 GTGGTTCCTGCCCTTCCTCGAGG + Intronic
1136595819 16:31249176-31249198 CTGGGTCCATCTCTTGCTTGTGG + Intergenic
1136618723 16:31413825-31413847 CTGGCTCCTGCTCATTCTCCAGG + Intronic
1136873219 16:33827022-33827044 CTGGGTCCTGCTCTCTCTTCAGG + Intergenic
1137083484 16:36095031-36095053 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
1137612803 16:49830183-49830205 CTGGCTCCTTCTCCTTCTTCTGG - Intronic
1138801518 16:60036073-60036095 CTGTTTGCTGTTGTTTCTTGTGG - Intergenic
1138811335 16:60154081-60154103 CTGCTTGCTTCACTTTCTTGTGG + Intergenic
1139308138 16:66005640-66005662 CTGGAGCCTAATCTTTCTTGAGG - Intergenic
1140194427 16:72845059-72845081 CAGGTTCCTGCTCCTCCGTGTGG + Intronic
1140842452 16:78852792-78852814 ATGGTTCCACCTGTTTCTTGAGG + Intronic
1141684244 16:85561431-85561453 CTGGTTCCTGTCGTTTCTGGAGG + Intergenic
1141760030 16:86022237-86022259 CTGGTATCAGCTCTTTCTCGTGG + Intergenic
1203098953 16_KI270728v1_random:1289033-1289055 CTGGGTCCTGCTCTCTCTTCAGG - Intergenic
1143801194 17:9382836-9382858 CTGCTTTCTGCTTTCTCTTGTGG - Intronic
1144466886 17:15504150-15504172 CTGGTTCCTGGGCTGTCTAGTGG - Intronic
1144802566 17:17940576-17940598 CTTATTCCTGCTCTTTGTTCAGG - Intronic
1146145227 17:30409965-30409987 CTCTTTCCTGCTTTCTCTTGTGG + Intronic
1146551000 17:33780412-33780434 CTACTTCTTGCTCTTGCTTGTGG - Intronic
1146766473 17:35526741-35526763 ATCTTTCCTGCTTTTTCTTGTGG - Intronic
1147561538 17:41512493-41512515 GTGGTGCCTGCTCTTTCTAGGGG - Intergenic
1148384250 17:47222872-47222894 GTAGTTCCTGCTCTTATTTGGGG - Intronic
1149146452 17:53499070-53499092 CTGGTTCCTTCACTTCCTTCAGG - Intergenic
1149323350 17:55504608-55504630 ATCGTTCCTGCTTTCTCTTGTGG - Intergenic
1149636313 17:58172768-58172790 CTGTTTGCTGTTGTTTCTTGTGG - Intergenic
1150720408 17:67609647-67609669 ATTCTTCCTGCTCTCTCTTGGGG - Intronic
1152322390 17:79615098-79615120 CTCGTTCCTGCTCTTTTTTATGG - Intergenic
1153578850 18:6550759-6550781 CTGTTTCCTTCTCTATCATGTGG + Intronic
1153635728 18:7111384-7111406 CTTGTTCCTCATCTTGCTTGGGG - Intronic
1153791588 18:8584297-8584319 CTGCTTCCTGGTCTGTGTTGGGG - Intergenic
1153959363 18:10127577-10127599 CTGGTCCAGGCTCTTCCTTGAGG + Intergenic
1154490294 18:14916919-14916941 CTGGTTCTGCCTCTTTCCTGTGG - Intergenic
1156084682 18:33383507-33383529 TTGCTTCCTGCTCTTTCCTCTGG - Intronic
1156338222 18:36187959-36187981 ATGGTTCTTGCCCTCTCTTGCGG + Intronic
1157904286 18:51554541-51554563 CTGTTTGCTGTTGTTTCTTGTGG + Intergenic
1158074667 18:53514334-53514356 ATCTTTCCTGCTCTCTCTTGTGG - Intronic
1159391294 18:67795972-67795994 GTGGTTCCACTTCTTTCTTGAGG - Intergenic
1159975653 18:74708630-74708652 CTGGCTCCAGCCCTTTCTGGGGG + Intronic
1160325875 18:77948062-77948084 CTGGTTCCTCCTCATCCTTCAGG - Intergenic
1161360920 19:3849237-3849259 CAGGTTCCTGCTCCTTCCTTGGG - Intronic
1161872272 19:6879313-6879335 CTGGCTCAAGCTCTTGCTTGAGG + Intergenic
1162998440 19:14350990-14351012 CTGAATCCCGCTCTTGCTTGCGG - Intergenic
1164340911 19:24396828-24396850 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1164341785 19:24409027-24409049 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
1164416969 19:28054408-28054430 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1165093376 19:33397805-33397827 CTGGTTCATGCTGACTCTTGGGG - Intronic
1165352699 19:35284813-35284835 CTGGCTCCAGCTCTGTCCTGGGG - Exonic
1165854299 19:38870570-38870592 CTGGATCCTCGTCCTTCTTGGGG + Exonic
1165975671 19:39674328-39674350 ATGCATCCTGCTATTTCTTGTGG - Intergenic
1166093142 19:40523221-40523243 CTGGCTCCTTCACTTTCTTCAGG - Intronic
1166274188 19:41740372-41740394 CTGGATCCTACTCCCTCTTGAGG - Intronic
1166285764 19:41827102-41827124 CTGTTTGCTGTTGTTTCTTGTGG + Intergenic
1167023735 19:46898940-46898962 CCTGTTACTGCTCTGTCTTGGGG - Intergenic
1167462880 19:49635644-49635666 CTTGTTCCTGGTATTTCCTGTGG + Exonic
1167586424 19:50378095-50378117 CTGGTTCCTGTTTCTCCTTGTGG + Intronic
1168171509 19:54592957-54592979 CTGGCCTCTGTTCTTTCTTGTGG + Intronic
1168241385 19:55090861-55090883 CTGTTTCCTGCTCCTGCTGGGGG - Intergenic
924959102 2:17866-17888 CAGGATCCTGCTCTTTCCTTTGG - Intergenic
925107349 2:1303598-1303620 CTGATATCTGCTCTTCCTTGGGG - Intronic
926384491 2:12322860-12322882 CTGACTCCTGCACTTTCTAGAGG - Intergenic
926567438 2:14491470-14491492 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
926917450 2:17906569-17906591 ATGTTTCCTGCTTTCTCTTGTGG + Intronic
926925793 2:17986237-17986259 ATGTTTCCTGCTTTCTCTTGTGG + Intronic
926970353 2:18461319-18461341 ATGTTTCCTGCTTTCTCTTGTGG + Intergenic
927494465 2:23543304-23543326 CTGTGCCCTCCTCTTTCTTGGGG - Intronic
927560824 2:24071724-24071746 CTGGCTCCTCCTCATTCTTCAGG - Intronic
930164584 2:48191715-48191737 CTGCTTGCTCCTCTTTCTTCTGG - Intergenic
930264440 2:49183612-49183634 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
931621773 2:64217673-64217695 CTGGTTCTTGCTCATTTTCGGGG + Intergenic
932209227 2:69914195-69914217 CCGATTCCAGCTCTTTCTTGAGG + Intronic
932868432 2:75371992-75372014 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
932999776 2:76907375-76907397 ATCTTTCCTGCTTTTTCTTGTGG - Intronic
933016830 2:77138504-77138526 ATGTTTCCTGCTTTTTCTTGTGG - Intronic
934099880 2:88642273-88642295 CTGGTTCTTCCTCTTCTTTGTGG - Intergenic
934912050 2:98267572-98267594 ATCTTTCCTGCTCTCTCTTGTGG - Intronic
936849001 2:116873576-116873598 TGGGTGCCTGCTCTTTCTTCTGG + Intergenic
937218826 2:120329804-120329826 CTGGTTGCTGCTCATTCCCGAGG + Intergenic
937798871 2:126058665-126058687 CTGGTTCCTTCTCATTTGTGTGG + Intergenic
938112765 2:128579954-128579976 CTGGTGCCGGCTCTTCCTTGAGG - Intergenic
938690358 2:133782814-133782836 CAGGGTCCTGCTCCTTCTAGAGG + Intergenic
938799343 2:134746374-134746396 CTGTTTGCTGTTCTTTCTCGTGG - Intergenic
939012370 2:136861839-136861861 CTGGCTCAGGATCTTTCTTGAGG + Intronic
939846958 2:147258908-147258930 CTGTTTCATGATCTTCCTTGGGG + Intergenic
941283774 2:163583841-163583863 CAGGTTCCTGCATTTTCATGGGG - Intergenic
941477910 2:165971108-165971130 CTGTTTCCTGTTGTTTCTTGTGG - Intergenic
942036700 2:172016919-172016941 CTAATTCCTGCTTGTTCTTGAGG + Intronic
942362757 2:175189764-175189786 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
942498847 2:176566923-176566945 GTGTTTCCTTCTCTTTCCTGTGG - Intergenic
942790438 2:179755040-179755062 ATGTTTCCTGCTTTCTCTTGTGG + Intronic
942924173 2:181411856-181411878 TGGGTGCCTGCTCTTTCTTCTGG - Intergenic
943334821 2:186600656-186600678 CTGATTCCTGCTCTTAATGGAGG - Intronic
944449833 2:199830959-199830981 CTGTTGCCTGTTTTTTCTTGAGG + Intronic
945351638 2:208787297-208787319 ATGTTTCCTGCTTTCTCTTGTGG - Intronic
945652614 2:212583506-212583528 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
946288845 2:218727871-218727893 CTGTTTGCTGTTATTTCTTGTGG + Intronic
946378203 2:219327066-219327088 CTGGACCCTGCTGTTTTTTGAGG - Intergenic
946495334 2:220190876-220190898 GTGGTTTCTGCTTTTTCTTTTGG - Intergenic
946579905 2:221117153-221117175 CTGGTTCCTTCTCGTACTTCAGG + Intergenic
946833128 2:223745253-223745275 CAGGGTCCTGCTGTTTCTTTTGG - Intergenic
947068084 2:226253110-226253132 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
948498812 2:238375238-238375260 ATCTTTCCTGCTTTTTCTTGTGG + Intronic
948633339 2:239316640-239316662 CAGGCTCCTGCTCATTCCTGTGG - Intronic
1169592614 20:7162363-7162385 AAGCTTCCTGTTCTTTCTTGAGG + Intergenic
1169894716 20:10490560-10490582 CTACTTCCTGCTCTTTTTTTGGG + Intronic
1169958454 20:11131912-11131934 CTGTTTCCTCCTCTTTCCTTTGG + Intergenic
1170294524 20:14809467-14809489 GTGTTTCCTGCTTTCTCTTGTGG - Intronic
1170697066 20:18668752-18668774 CTGCTCACTGTTCTTTCTTGAGG + Intronic
1170863442 20:20130426-20130448 ATGTTTCCTGATGTTTCTTGTGG + Intronic
1171197044 20:23207897-23207919 CTGTTTCCTGTTATTTTTTGTGG - Intergenic
1171508309 20:25657869-25657891 CTGTTTACTGTTGTTTCTTGTGG + Intergenic
1172045151 20:32074848-32074870 CTGGCTCCTTCTCTTCCTTCAGG + Intronic
1172834880 20:37866887-37866909 CTGGTCCCTGCTTTTCCTGGTGG - Intronic
1172997044 20:39078567-39078589 CTGGTTCCTGCTGTTCCTTCTGG + Intergenic
1173043379 20:39486703-39486725 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1173723843 20:45283355-45283377 CTGGATTCTGCTCCTTCTCGTGG - Intergenic
1173770713 20:45654464-45654486 ATCTTTCCTGCTCTCTCTTGTGG - Intronic
1174061934 20:47839158-47839180 CTGGCTCCTCCTCTTTCCTCAGG - Intergenic
1174069574 20:47890073-47890095 CTGGCTCCTCCTCTTTCCTCAGG + Intergenic
1174171687 20:48621577-48621599 GTGGTTCCTGCTCTTACTGCTGG + Intergenic
1174277599 20:49415029-49415051 GTGGTTGCTGATATTTCTTGTGG - Intronic
1174470880 20:50759675-50759697 GTAGTTCTTCCTCTTTCTTGTGG - Intergenic
1175360121 20:58403166-58403188 CTGGTTGCTTTTCTCTCTTGTGG + Intronic
1175745547 20:61454401-61454423 CTGACTCCTACTCTGTCTTGCGG - Intronic
1177049985 21:16220985-16221007 CAGGTTCATGTTCTTTTTTGAGG + Intergenic
1177116582 21:17093399-17093421 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1178718785 21:34990357-34990379 GGGGTTCCTGCTCTTCCCTGGGG - Intronic
1178894292 21:36545952-36545974 CTGGTTCTCGCTCTTGCTGGAGG - Intronic
1179021972 21:37648719-37648741 CTTCTTCCTGCTATTTCTTGGGG + Intronic
1179353979 21:40641523-40641545 CTGGTTCCAGTTCTTTCTTTTGG + Intronic
1179771372 21:43620193-43620215 CTGTTTCCTGTTGTTTCTTATGG - Intronic
1182009326 22:26987104-26987126 CTGACTCCTGCTCATTCTTCAGG + Intergenic
1182369576 22:29801551-29801573 CTGGTTCCTGCTGTCCCATGGGG + Intronic
1182658781 22:31910433-31910455 CTGATTCCTCCTCTCTCTGGTGG + Intergenic
1182997289 22:34825869-34825891 CTGGTTCCTGTCCTTTCTGCCGG + Intergenic
1183480169 22:38059429-38059451 CTGACTCCTTCTCATTCTTGAGG + Intronic
1183582618 22:38734969-38734991 CTGGTTCCGGCTGTGTCTGGTGG - Exonic
1184200704 22:42967279-42967301 CTGGTCCCTGCTCTCCTTTGAGG - Intronic
1185264436 22:49892506-49892528 CTGGTTGCTGCTTGTGCTTGAGG + Intergenic
949119842 3:372966-372988 TGGGTGCCTGCTCCTTCTTGTGG + Intronic
949250122 3:1973484-1973506 CTGTTTGCTGTTGTTTCTTGTGG - Intergenic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950539060 3:13599271-13599293 CAGGCTCCTTCTCTTTCTGGGGG - Intronic
951033278 3:17906138-17906160 CTGGTTTCTGCCATTTCTTGTGG + Intronic
951361096 3:21725215-21725237 ATCTTTCCTGCTTTTTCTTGTGG - Intronic
951739599 3:25905863-25905885 GTGGTTTCTACTCTTTCTTTGGG + Intergenic
951759274 3:26127558-26127580 CTTATTCCTGCTTTCTCTTGTGG + Intergenic
951759863 3:26135373-26135395 ATGCTTCCTGCTCTTGCATGAGG + Intergenic
951813214 3:26724342-26724364 TTGGTTCCTGCTGCTTCCTGAGG + Intergenic
952056588 3:29453960-29453982 CTGGTTGTGGCTCTATCTTGTGG - Intronic
952563146 3:34620011-34620033 CTGTTTGCTGTTGTTTCTTGTGG + Intergenic
953254931 3:41280691-41280713 ATCTTTCCTGCTCTCTCTTGTGG - Intronic
953301714 3:41783818-41783840 ATGTTTCCTGCTGTTTATTGGGG - Intronic
953527748 3:43708192-43708214 CTGGTTCTTTGTTTTTCTTGTGG + Intronic
955132830 3:56187957-56187979 CTGGTTCCTGCTCATCCTTCAGG - Intronic
955135735 3:56216026-56216048 ATCTTTCCTGCTTTTTCTTGTGG - Intronic
955359593 3:58261647-58261669 CTGGTTCTTTCTTTTTATTGTGG + Intronic
956616281 3:71176072-71176094 CTGGTACCTTGTGTTTCTTGAGG - Intronic
957037567 3:75309082-75309104 TTGGTTCCACCTCTCTCTTGGGG - Intergenic
958268880 3:91473449-91473471 CTGGTTCCTGCTCTAACTTTTGG + Intergenic
958825672 3:99027128-99027150 CTGTTTGCTGTTGTTTCTTGTGG - Intergenic
959285490 3:104403511-104403533 CAAATTCCTGCTCTTTCTTTAGG - Intergenic
959679876 3:109082389-109082411 CTGTTTGCTGTTGTTTCTTGTGG - Intronic
959764614 3:110010695-110010717 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
960278475 3:115753924-115753946 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
960499828 3:118423479-118423501 CTGCCTGCTGCTGTTTCTTGTGG - Intergenic
960850157 3:122045026-122045048 ATGTTTCCTGCTTTCTCTTGTGG + Intergenic
961067253 3:123885739-123885761 CTGGTGTTTGCTCTTTTTTGAGG + Intergenic
961355249 3:126334455-126334477 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
961861389 3:129919199-129919221 CCTGGTCCTGCTCTTTATTGGGG - Intergenic
962708273 3:138065274-138065296 CTGCTTCCTGGTCATTCCTGAGG - Intronic
962928107 3:140013400-140013422 CTTGTTCCGGCTCTTTGTTTTGG + Intronic
963003287 3:140703448-140703470 CTGGCTCCTGCTCATTCTTGAGG - Intergenic
963038210 3:141050676-141050698 CTGGTATCTGCGCTTCCTTGGGG - Intergenic
964044077 3:152300118-152300140 TTGGTTGTTGCTCTTTTTTGGGG + Exonic
964305517 3:155335468-155335490 CTGGTTCCAGTTGTTTCTTCTGG + Intergenic
965499810 3:169443897-169443919 CTGGCTCCTCCACTCTCTTGAGG + Intronic
965654764 3:170972551-170972573 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
965955867 3:174368117-174368139 CTGTTTGCTGGTGTTTCTTGTGG - Intergenic
965963155 3:174452818-174452840 CTGGTTCTTTCTCATCCTTGTGG - Intronic
966250420 3:177859810-177859832 TGGGTTCCTGCTCCTTCTTCTGG + Intergenic
967173780 3:186844542-186844564 CTGGCTCCTTGTCTTTTTTGGGG + Intronic
967181199 3:186906624-186906646 ATCGTTCCTGCTTTCTCTTGTGG + Intergenic
967336008 3:188345475-188345497 CTGTTTCCTGCACATTGTTGGGG + Intronic
967673327 3:192265885-192265907 CTGTTACTTGCTCTTTCTTTTGG + Intronic
967756702 3:193178318-193178340 CAGGTTCCTTCTCATTCTTCAGG + Intergenic
968374586 4:28314-28336 CAGGATCCTGCTCTTTCCTGTGG - Intergenic
968826663 4:2903092-2903114 CTGGGTACTGCTCTTTTTTGGGG - Intronic
970225073 4:13849409-13849431 GGGGTTCCTGCTCCATCTTGGGG - Intergenic
971035180 4:22685185-22685207 ATGATCCATGCTCTTTCTTGGGG - Intergenic
971197980 4:24487369-24487391 CTTGTTCCTGCATTTTCCTGGGG + Intergenic
972178505 4:36437188-36437210 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
972350271 4:38230461-38230483 CTGCTACCTGCTGTTTCTTTAGG + Intergenic
973542713 4:51950603-51950625 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
974265862 4:59584910-59584932 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
974326219 4:60418714-60418736 CTGCTGCCTGCTCTTTCTTCTGG + Intergenic
974371401 4:61021033-61021055 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
974947480 4:68545457-68545479 ATGTTTCCTGCTTTCTCTTGTGG - Intronic
975316383 4:72957750-72957772 CTGGGTCTTTCTCTTTATTGAGG - Intergenic
975413577 4:74083064-74083086 CACGTTCCTCCTCTTTCTTTTGG + Intergenic
975419558 4:74147081-74147103 CTGTTTGCTGTTGTTTCTTGTGG + Intronic
975930401 4:79514791-79514813 CTAGTTACTGCTCCTTTTTGTGG + Intergenic
976272364 4:83243832-83243854 ATCTTTCCTGCTCTCTCTTGTGG - Intergenic
976289315 4:83400914-83400936 CTCTTTCCTGCTCTCTCTTGTGG - Intergenic
976462180 4:85325161-85325183 ATCGTTCCTGCTTTCTCTTGTGG - Intergenic
976477681 4:85503825-85503847 ATCGTTCCTGCTTTCTCTTGTGG + Intronic
976736887 4:88319348-88319370 ATGTTTCCTTTTCTTTCTTGGGG - Intergenic
978306984 4:107339722-107339744 CTGTTTGCTGTTGTTTCTTGTGG - Intergenic
978583118 4:110252063-110252085 TGAGTTCCTGCTCATTCTTGGGG + Intergenic
979085843 4:116408602-116408624 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
979380829 4:120004519-120004541 CTGTTTGCTGCTGTTTCTTGTGG - Intergenic
980421688 4:132568872-132568894 CTGGTTTCTACTATTTCTAGTGG - Intergenic
980612291 4:135174567-135174589 CACGTTCCTCCTCTTTCTTTTGG - Intergenic
980662045 4:135873535-135873557 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
980778340 4:137464748-137464770 CATGTTCCTGCTCTTACTTTTGG + Intergenic
981387708 4:144151017-144151039 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
981814579 4:148815926-148815948 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
981900729 4:149858674-149858696 CTGTTTGCTGTTATTTCTTGTGG - Intergenic
982910675 4:161137960-161137982 CTGTTTGCTGTTGTTTCTTGCGG - Intergenic
983364380 4:166767297-166767319 CTCTTTCCTGCTTTCTCTTGTGG + Intronic
984033435 4:174634704-174634726 CAGGTTCCTTTTCTTTCTGGGGG - Intergenic
984605645 4:181782729-181782751 ATCTTTCCTGCTTTTTCTTGCGG + Intergenic
985468495 5:20868-20890 CAGGATCCTGCTCTTTCCTTTGG - Intergenic
986031742 5:3901141-3901163 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
986270913 5:6229976-6229998 CTGCTACCTGCTCTTCCTTCTGG + Intergenic
986879676 5:12154292-12154314 CTGCTTCCTGCTTCTTCTTCTGG - Intergenic
987873021 5:23644987-23645009 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
989334501 5:40299851-40299873 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
989357802 5:40564491-40564513 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
989651046 5:43690636-43690658 CTGCTTCTTGCTCTTACTAGTGG + Intronic
989958133 5:50378515-50378537 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
990224006 5:53628987-53629009 CTCTTTCCTGCTTTCTCTTGTGG + Intronic
990515795 5:56529894-56529916 CTGGTTCCTGCTTTTTGTCCTGG + Intronic
991052193 5:62285208-62285230 CTGGATCTTGCTTTTTCTTTGGG + Intergenic
991257872 5:64634971-64634993 CTGCTTCCTGCGCTCACTTGGGG - Intergenic
992009428 5:72512028-72512050 CTGACTCATGCTCATTCTTGAGG - Intergenic
992194194 5:74323832-74323854 CTGGTTTCTCCTCAGTCTTGGGG + Intergenic
992254784 5:74911113-74911135 TTGCTGCCTGCTCTTTCTTCTGG + Intergenic
992281207 5:75178767-75178789 ATGTTTCCTGCTTTCTCTTGTGG - Intronic
992370066 5:76134571-76134593 TTTGTTCCTGGTCTTCCTTGAGG - Intronic
992919196 5:81495117-81495139 CTGGTTCCTTCTAATTCTTAGGG - Intronic
993277214 5:85875783-85875805 CTAGTTCCTACTCTTTGTTTGGG - Intergenic
993449894 5:88060609-88060631 CTGACTCCTGCTCATTCTTCAGG + Intergenic
993688755 5:90972735-90972757 ATCGTTCCTGCTTTCTCTTGTGG - Intronic
993936829 5:94014493-94014515 CTGTTTGCTGTTGTTTCTTGTGG - Intronic
994048797 5:95339211-95339233 ATCTTTCCTGCTCTCTCTTGTGG - Intergenic
994068055 5:95565461-95565483 CTGGATCCTGTTCATTCTTTAGG + Intronic
994167229 5:96620416-96620438 ATGCTTCATGATCTTTCTTGTGG + Intronic
994257221 5:97613005-97613027 CTGGTTCTTGATCTTACTTCAGG - Intergenic
994263037 5:97682376-97682398 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
994574124 5:101554597-101554619 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
995327298 5:110905567-110905589 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
995343666 5:111087992-111088014 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
995690115 5:114816409-114816431 ATCGTTCCTGCTTTCTCTTGTGG + Intergenic
995824044 5:116272844-116272866 CTGGTTTCTGCTCTTAATTTCGG + Intronic
995905195 5:117114904-117114926 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
997252592 5:132401121-132401143 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
997435247 5:133869409-133869431 CTGTTTTCTACTTTTTCTTGTGG - Intergenic
997735375 5:136209089-136209111 CTGGTCCCTGCTCATTCTAGAGG + Intergenic
998017262 5:138742301-138742323 CTGGCTCCTTCTCATTCCTGAGG - Intronic
998460808 5:142308716-142308738 CTGGTTCTTGGTTTTTCTAGGGG - Intergenic
998594739 5:143516855-143516877 CTGATTCCTCCCCTTTCTAGTGG + Intergenic
998701746 5:144710297-144710319 CTGGTGCCTTCTCATTCTTCAGG + Intergenic
998793929 5:145797279-145797301 CTGGGTGCTGCTAATTCTTGAGG - Intronic
999400119 5:151257972-151257994 CTGGCTCCTGCCCTGCCTTGAGG - Intronic
999944344 5:156579020-156579042 ATCTTTCCTGCTTTTTCTTGTGG + Intronic
1000069248 5:157723986-157724008 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1000404855 5:160876418-160876440 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1000424443 5:161074243-161074265 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1000468443 5:161609164-161609186 ATCGTTCCTGCTTTCTCTTGTGG + Intronic
1000591885 5:163168070-163168092 ATGTTTCCTGCTTTGTCTTGTGG - Intergenic
1000598123 5:163239175-163239197 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1000681547 5:164191140-164191162 CTGGTCCCTGCTCTCTCTTTAGG + Intergenic
1001994429 5:176144290-176144312 CTGGTGCCTCTTCTTTTTTGAGG - Intergenic
1002493798 5:179598508-179598530 CTGGTTCCTGCTCTTTCTTGTGG + Intronic
1002755563 6:156368-156390 CAGGATCCTGCTCTTTCGTTTGG - Intergenic
1003079653 6:3011059-3011081 CTGTTTACTGTTGTTTCTTGTGG - Intronic
1003438466 6:6117319-6117341 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
1003522361 6:6868914-6868936 CCCCTTCCTGCTCTTTCTTTGGG - Intergenic
1003797867 6:9625615-9625637 CTTTTTCCTGCATTTTCTTGTGG + Intronic
1003834617 6:10057658-10057680 CTGGCTCCTGGCCTCTCTTGAGG - Intronic
1004833049 6:19498071-19498093 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1005530510 6:26700444-26700466 ATGTATCCTGCTTTTTCTTGAGG + Intergenic
1005540286 6:26801202-26801224 ATGTATCCTGCTTTTTCTTGAGG - Intergenic
1005712156 6:28512692-28512714 CTTGCTGCTGCTCATTCTTGGGG + Intronic
1006425933 6:33963011-33963033 CTCCTTCCTGCTCCTTCCTGTGG + Intergenic
1006810706 6:36818686-36818708 CTGGCTCCAGCCCTTTCTGGAGG - Intronic
1006891796 6:37434910-37434932 CTGGTTTCCACTCTTTTTTGTGG + Intronic
1007429309 6:41767539-41767561 CTGGATCCTGTCCTTTCCTGAGG + Intergenic
1007513996 6:42396810-42396832 CTGGGTCCTTCTAGTTCTTGGGG - Intronic
1007845364 6:44750458-44750480 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1008592801 6:53010703-53010725 TTGGTTCCTTCTCATTCTTTGGG + Intronic
1008635119 6:53403177-53403199 ATGTTTCCTGCTTTCTCTTGTGG + Intergenic
1008986349 6:57548273-57548295 CTGGTTCCTGCTCTAACTTTTGG - Intronic
1009011103 6:57843302-57843324 ATGTATCCTGCTTTTTCTTGAGG - Intergenic
1009174312 6:60440850-60440872 CTGGTTCCTGCTCTAACTTTTGG - Intergenic
1009233514 6:61094704-61094726 ATCTTTCCTGCTCTCTCTTGTGG - Intergenic
1009273889 6:61650143-61650165 CTGGTTCCTTTTCTTCCTTCAGG + Intergenic
1009442831 6:63702603-63702625 CTGCTTCCTGTTCTTTCATTGGG - Exonic
1009621509 6:66084269-66084291 CTGGTTCTTTCTCATTTTTGTGG + Intergenic
1009652350 6:66492063-66492085 ATTTTTCCTGCTTTTTCTTGTGG - Intergenic
1010298370 6:74228217-74228239 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1010307371 6:74340891-74340913 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
1010334340 6:74663025-74663047 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1010463543 6:76140890-76140912 TTGTTTCCTGCTTTCTCTTGTGG + Intergenic
1010672027 6:78697328-78697350 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1010718888 6:79261247-79261269 ATGGTGCCTGCTCCTTCTTCTGG + Intergenic
1010728791 6:79366005-79366027 ATGTTTCCTGCTTTCTCTTGTGG + Intergenic
1011012534 6:82718227-82718249 ATCTTTCCTGCTCTCTCTTGTGG - Intergenic
1011144986 6:84204611-84204633 ATCTTTCCTGCTTTTTCTTGTGG - Intronic
1012411531 6:98963810-98963832 CTGGGTCCTGCACATTTTTGAGG - Intergenic
1012742258 6:103033074-103033096 CTGGTGCCTGCTCTTTTTGGAGG - Intergenic
1013387972 6:109651451-109651473 ATCGTTCCTGCTTTCTCTTGTGG - Intronic
1014176915 6:118341636-118341658 CTGGTTCCTCCCCTTTTTCGTGG + Intergenic
1014352787 6:120364722-120364744 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1014409764 6:121100619-121100641 ATCTTTCCTGCTTTTTCTTGTGG - Intronic
1014490397 6:122055107-122055129 CTGGTTCTGCCTCTTTCTAGAGG + Intergenic
1014854479 6:126382330-126382352 CTGGTTCTTTCTCATTTTTGTGG - Intergenic
1014871057 6:126596937-126596959 ATCGTTCCTGCTTTCTCTTGTGG + Intergenic
1015133299 6:129838468-129838490 CTCTTTCCTGCTTTCTCTTGTGG - Intronic
1015273999 6:131365817-131365839 CTGGATCCTTCTCTGTCTGGTGG - Intergenic
1015384863 6:132610486-132610508 CCAGTTTTTGCTCTTTCTTGGGG - Intergenic
1016263808 6:142207740-142207762 CTGTTTGCTGTTGTTTCTTGTGG - Intronic
1016277877 6:142376289-142376311 CTGATTACTACTCTTTCCTGAGG + Intronic
1016817180 6:148313767-148313789 CTGCTACCTGCTCCTTCTGGCGG + Intronic
1016997655 6:149971406-149971428 CTGGGTCCTGCTCTCCCTTCAGG + Exonic
1017001153 6:149998825-149998847 CTGGGTCCTGCTCTCCCTTCAGG - Intergenic
1017010863 6:150063292-150063314 CTGGTTCCTGCTCTCCCTTCAGG - Exonic
1018319821 6:162595554-162595576 CTTGTTCCTGATTTTTCTTGAGG + Intronic
1019698379 7:2460473-2460495 CTGGTTCCGGCTTTGTCTCGGGG + Intergenic
1019858679 7:3635918-3635940 CTGGTTCCTTTTCTTTCTTACGG + Intronic
1020143278 7:5624013-5624035 CTGGCTGCTGCTCTGTCCTGGGG + Intronic
1020210441 7:6154448-6154470 CTTGCTCCTGCTCTCTCTGGCGG - Exonic
1021202006 7:17737716-17737738 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
1021544130 7:21794288-21794310 CTGTTTGCTGCTGTCTCTTGTGG + Intronic
1021626063 7:22594403-22594425 CTGGTTCATGCTTATTCTTAGGG - Intronic
1021771806 7:24010502-24010524 CTGTTTGCTGTTGTTTCTTGTGG + Intergenic
1021817626 7:24463710-24463732 CTGGGATATGCTCTTTCTTGTGG - Intergenic
1022619373 7:31966992-31967014 ATCGTTCCTGCTTTCTCTTGTGG - Intronic
1022634729 7:32120512-32120534 CTGGTGCCTGCTCCTTCTTCTGG - Intronic
1025232525 7:57212006-57212028 CTGGCTCCTCCTCTTTCCTCAGG + Intergenic
1026844695 7:73692003-73692025 CTGGCCACTGGTCTTTCTTGGGG + Intronic
1027944123 7:84723369-84723391 TGGGTGCCTGCTCTTTCTTCTGG - Intergenic
1028080587 7:86570216-86570238 ATTGTTCCTGCTTTCTCTTGTGG - Intergenic
1028170121 7:87586177-87586199 CTTTTTTCTGCTCATTCTTGAGG - Intronic
1028186293 7:87789802-87789824 GTCGTTCTTGCTCTTTCTTCAGG - Intronic
1028189244 7:87825833-87825855 CTGGATTCTGGACTTTCTTGGGG + Intronic
1028252558 7:88554147-88554169 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
1028262498 7:88683659-88683681 CTGGTTCCCACACTTTCTTGAGG - Intergenic
1028277526 7:88875192-88875214 ATGTTTCCTGCTTTCTCTTGTGG - Intronic
1028629773 7:92922324-92922346 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
1029780363 7:102725571-102725593 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1029800882 7:102946465-102946487 CTGGTACCTGCTCCTCTTTGGGG - Intronic
1030965839 7:115992239-115992261 ATCTTTCCTGCTCTCTCTTGTGG - Intronic
1030997314 7:116374267-116374289 ATCTTTCCTGCTCTCTCTTGTGG - Intronic
1031366252 7:120903737-120903759 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1031664297 7:124465835-124465857 ATATTTCCTGCTTTTTCTTGTGG + Intergenic
1031850153 7:126853723-126853745 CTGGGTCCTGCCCATTCCTGAGG - Intronic
1033529645 7:142248944-142248966 CTGCTCCCAGCTCTTTATTGAGG - Intergenic
1033887803 7:145969583-145969605 ATCGTTCCTGCTTTCTCTTGTGG - Intergenic
1034301012 7:150015372-150015394 CTGGAGCCACCTCTTTCTTGGGG - Intergenic
1034361102 7:150499135-150499157 GTGTTTCCTGCTTTCTCTTGTGG - Intergenic
1034526445 7:151666576-151666598 CTGGTTCATGGTCTTTTATGAGG + Intronic
1034805040 7:154081930-154081952 CTGGAGCCACCTCTTTCTTGGGG + Intronic
1035087758 7:156275823-156275845 CTGGTCCCTCCTCATTCTTCAGG + Intergenic
1035268347 7:157704684-157704706 GTGGTTCCTGTTCTGTCCTGGGG - Intronic
1035445259 7:158936992-158937014 CTGTTTGCTGCTGTTTCTTGTGG - Intronic
1036545162 8:9761183-9761205 CTGATTCCTCCTCTATCTTGAGG + Intronic
1039145450 8:34441383-34441405 ATGTTTCCTGCTTTTTCTTGTGG - Intergenic
1039755402 8:40517212-40517234 CTGGATTCTGTTCTTTCTTCTGG + Intergenic
1039849847 8:41355052-41355074 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
1040013885 8:42684792-42684814 ATCCTTCCTGCTTTTTCTTGTGG - Intergenic
1040462603 8:47663171-47663193 CTGGTTGCTTCTCTCTCTTTAGG + Intronic
1040696969 8:50011655-50011677 CTGGTTCCTTCTGTTTCCTTTGG + Intronic
1041665589 8:60441739-60441761 ATGTTTCCTGCTTTCTCTTGTGG + Intergenic
1042088321 8:65132295-65132317 CTTGTTCCTTGTCTTGCTTGGGG + Intergenic
1042380083 8:68103771-68103793 CTGGTTTTTGTCCTTTCTTGTGG + Intronic
1042421873 8:68601149-68601171 CTGTTTCTTCCTCTTTCATGTGG + Intronic
1042766143 8:72323993-72324015 ATCGTTCCTGCTTTCTCTTGTGG - Intergenic
1043131764 8:76471811-76471833 CTGGTTCCTTCTCATCTTTGTGG + Intergenic
1044221485 8:89675150-89675172 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1044812073 8:96073436-96073458 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1045070877 8:98503510-98503532 ATCGTTCCTGCTTTCTCTTGTGG + Intronic
1045354317 8:101371913-101371935 CTGGTTCTTTCTGTTTCATGGGG + Intergenic
1045500391 8:102740128-102740150 CTGGATCCAGCTCTCTCCTGTGG - Intergenic
1045647292 8:104311596-104311618 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1045882955 8:107062791-107062813 ATGTTTCCTGCTTTCTCTTGTGG + Intergenic
1047710067 8:127542699-127542721 CTGGTGCCAGCTGTTTGTTGGGG - Intergenic
1048109757 8:131454619-131454641 CTGGTTCTTTCTCTTTTGTGTGG - Intergenic
1048713723 8:137243395-137243417 ATCTTTCCTGCTCTCTCTTGTGG - Intergenic
1049169123 8:141147528-141147550 CTGTTTCCTCCATTTTCTTGTGG + Intronic
1049305237 8:141899377-141899399 CTCGTTCCTCCTCTTTGATGTGG + Intergenic
1049382886 8:142326127-142326149 CTGGTTCCTCATCTGTCTCGTGG - Intronic
1049382936 8:142326327-142326349 CTGGTTCCTCATCTGTCTCGTGG - Intronic
1049601880 8:143511755-143511777 CTCGTGCCTGCTATTTCTGGAGG - Intronic
1049882733 8:145078048-145078070 ATGTTTCCTGCTTTCTCTTGTGG + Intergenic
1050075774 9:1862015-1862037 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1050387277 9:5103950-5103972 CTCTTTCCTGCTTTCTCTTGTGG - Intronic
1050390280 9:5135655-5135677 CTCTTTCCTGCTTTCTCTTGTGG - Intronic
1050603882 9:7280793-7280815 ATGTTTCCTGCTTTCTCTTGTGG + Intergenic
1050835418 9:10072455-10072477 CTTGTTGCTGCTCTCTCTTTGGG - Intronic
1051125189 9:13795553-13795575 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1052451673 9:28638928-28638950 CTCTTTCCTGCTTTCTCTTGTGG + Intronic
1052490511 9:29160998-29161020 CTGGTTCTCTCTCTTTCTTTGGG - Intergenic
1052794842 9:32913961-32913983 CTGGTTCCCAATCTCTCTTGGGG + Intergenic
1052951107 9:34212815-34212837 ATGGTTCCTTCTTTATCTTGTGG - Intronic
1055244405 9:74222168-74222190 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1055695152 9:78875527-78875549 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1056322434 9:85448919-85448941 AGGGTTCCTTCTCTATCTTGTGG + Intergenic
1057114037 9:92503416-92503438 CTGTTTCCTACTATTTCATGTGG + Intronic
1058096710 9:100869835-100869857 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1058209561 9:102150853-102150875 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
1058224236 9:102340232-102340254 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
1058338306 9:103861427-103861449 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1059227460 9:112685359-112685381 CTGGTACCTGCTCTTTTAGGAGG - Exonic
1059997740 9:119929030-119929052 CTGTTTCCTCTTCTTGCTTGGGG + Intergenic
1061301664 9:129709230-129709252 CTGGCCCCTCCGCTTTCTTGTGG + Intronic
1062630666 9:137461737-137461759 CCGGTCCCTGCCCTTACTTGGGG - Intronic
1062715518 9:138008254-138008276 CTGGCCACTGCTCTGTCTTGAGG - Intronic
1203443943 Un_GL000219v1:37002-37024 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1203514751 Un_KI270741v1:155911-155933 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1203574633 Un_KI270744v1:165836-165858 CAGGATCCTGCTCTTTCCTGTGG + Intergenic
1186278665 X:7968503-7968525 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1187271519 X:17784480-17784502 ATGTTTCCTGCTTTCTCTTGTGG + Intergenic
1187307350 X:18107783-18107805 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1187672163 X:21678593-21678615 CTGCTTCGTGGTCTTTCATGAGG - Intergenic
1188288983 X:28365193-28365215 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
1189182348 X:39016285-39016307 TTGGTTACTCCACTTTCTTGTGG + Intergenic
1189557985 X:42165336-42165358 CTGGTTCTTTCTCATTTTTGTGG + Intergenic
1190943664 X:55070145-55070167 ATGTTTCCTGCTTTCTCTTGTGG + Intergenic
1191124215 X:56937268-56937290 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
1191798952 X:65056198-65056220 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
1191808466 X:65160869-65160891 ATCGTTCCTGCTTTCTCTTGTGG + Intergenic
1192697357 X:73431737-73431759 ATCGTTCCTGCTTTCTCTTGTGG + Intergenic
1192732565 X:73816008-73816030 TTGGTTCATTCTCTTTCTTTTGG + Intergenic
1192907223 X:75564383-75564405 ATGTTTCCTGCTTTCTCTTGTGG + Intergenic
1192918770 X:75683626-75683648 ATGTTTCCTGCTTTCTCTTGTGG + Intergenic
1193062454 X:77220710-77220732 TGGGTTCCTGCTCCTTTTTGTGG - Intergenic
1193089965 X:77483126-77483148 CTGGTTCTTTCTCATTTTTGTGG - Intergenic
1193194072 X:78609241-78609263 CTGTTTCTTTCTCTTTTTTGGGG + Intergenic
1193284538 X:79696632-79696654 TTGCTGCCTGCTCTTTCTTCTGG + Intergenic
1193623464 X:83786633-83786655 CTGTTTGCTGTTGTTTCTTGTGG - Intergenic
1193894625 X:87098204-87098226 CTGGTTCTTTCTCATTGTTGTGG + Intergenic
1194525861 X:94977150-94977172 CTGGTTCTTTCTCTTCTTTGTGG + Intergenic
1194549268 X:95275135-95275157 CTGATTCCTTCTCATTTTTGTGG - Intergenic
1194727191 X:97412436-97412458 ATGTTTCCTGCTTTCTCTTGTGG - Intronic
1196075897 X:111575725-111575747 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1196737088 X:118989515-118989537 CTTCTTCCTGGTCTTTCATGTGG - Exonic
1197447184 X:126564779-126564801 ATCTTTCCTGCTCTCTCTTGTGG + Intergenic
1197497078 X:127197170-127197192 CTGTTTTCTGTTGTTTCTTGTGG - Intergenic
1197790567 X:130249698-130249720 CTGGTTCTTTCTCTTCTTTGTGG - Intronic
1198072435 X:133162386-133162408 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1198172423 X:134120194-134120216 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
1198335539 X:135662623-135662645 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
1198663767 X:138999218-138999240 ATCTTTCCTGCTTTTTCTTGTGG - Intronic
1199181773 X:144865512-144865534 CTGGTGCTTTCTCTTTCGTGAGG + Intergenic
1200122590 X:153798146-153798168 CTGGTCCCTCCTCCTTTTTGGGG + Intronic
1200583316 Y:4976264-4976286 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1200723064 Y:6629673-6629695 ATCCTTCCTGCTCTCTCTTGTGG - Intergenic
1200935009 Y:8730626-8730648 CTGGTTCCTGCTATTACAAGAGG - Intergenic
1201249536 Y:12042389-12042411 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1201462353 Y:14240091-14240113 TTGCTTCCTGCTCCTTCCTGTGG - Intergenic
1201577166 Y:15473366-15473388 CTTTTACCTGCTCATTCTTGAGG + Intergenic
1202022498 Y:20480088-20480110 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1202333143 Y:23776109-23776131 ATGTTTCCTGCTTTCTCTTGTGG + Intergenic
1202537626 Y:25893954-25893976 ATGTTTCCTGCTTTCTCTTGTGG - Intergenic
1202577435 Y:26342558-26342580 ATCTTTCCTGCTCTCTCTTGTGG - Intergenic