ID: 1002493923

View in Genome Browser
Species Human (GRCh38)
Location 5:179599222-179599244
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002493914_1002493923 5 Left 1002493914 5:179599194-179599216 CCTCAGGCGGCAGGCAGGAGGAA 0: 1
1: 0
2: 1
3: 40
4: 336
Right 1002493923 5:179599222-179599244 TCATGGGCCCTGGGAGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr