ID: 1002500083

View in Genome Browser
Species Human (GRCh38)
Location 5:179642655-179642677
Sequence CACCCACCAGGTGTGTGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 3, 1: 0, 2: 1, 3: 15, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002500079_1002500083 3 Left 1002500079 5:179642629-179642651 CCTCGGATCACTCGAGGGCTAGA 0: 3
1: 0
2: 0
3: 0
4: 24
Right 1002500083 5:179642655-179642677 CACCCACCAGGTGTGTGGACAGG 0: 3
1: 0
2: 1
3: 15
4: 187
1002500076_1002500083 9 Left 1002500076 5:179642623-179642645 CCAACGCCTCGGATCACTCGAGG 0: 3
1: 0
2: 0
3: 1
4: 80
Right 1002500083 5:179642655-179642677 CACCCACCAGGTGTGTGGACAGG 0: 3
1: 0
2: 1
3: 15
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002500083 Original CRISPR CACCCACCAGGTGTGTGGAC AGG Intronic
900322698 1:2092980-2093002 CAGCTTCCAGGTGTGGGGACCGG + Intronic
900390783 1:2432922-2432944 CACCCAGCCCGTGTGTGCACCGG - Intronic
901056134 1:6449338-6449360 CACCCCCTAGCTGTGTGGCCTGG + Intronic
901239270 1:7683560-7683582 CATCCACCTGGAGTGGGGACTGG + Intronic
902478222 1:16699157-16699179 CACCCTCTAGCTGTGTGGCCTGG - Intergenic
902618663 1:17637994-17638016 CACCTACCAGGTACGTGGCCTGG + Exonic
903577185 1:24346342-24346364 CACGCACTAGGTGTGTGACCTGG - Intronic
904987239 1:34561986-34562008 TTCCAACCAGCTGTGTGGACTGG - Intergenic
905919183 1:41708070-41708092 CATCCCCCAGGTGAGTGCACAGG + Intronic
906157188 1:43620614-43620636 CATCCACCCAGCGTGTGGACAGG - Intronic
906700046 1:47851086-47851108 CCACCACCTGGTCTGTGGACTGG - Intronic
912954538 1:114145378-114145400 CACCCACTAGTTGTGTGACCTGG - Intronic
919912277 1:202118914-202118936 CACCCTCCAGGGGGGTGGAGGGG + Intergenic
921488199 1:215740980-215741002 CACTCACCTGCTGTGTGGCCCGG + Intronic
924486319 1:244487280-244487302 CACCCACCAGGTGACTAGAAGGG - Intronic
1063102586 10:2963330-2963352 ACCCCACCAGGTGTGTGGCCAGG - Intergenic
1063519309 10:6726548-6726570 CACCCACGAAGTGTGTGGCCTGG + Intergenic
1065815368 10:29478509-29478531 CACTTACCAGCTGTGTGGGCTGG - Intronic
1067560770 10:47302910-47302932 CAGCTACCAGGTGTGTGCAGTGG + Intronic
1069918067 10:71799271-71799293 CTCCTACCAGGTGGGTGGCCAGG + Exonic
1071522673 10:86340835-86340857 CACCCTCCAGGTGTTTGTCCAGG - Intronic
1072067011 10:91881102-91881124 CACCCGCCAGGTGAGTGAATGGG - Intergenic
1073469442 10:103713792-103713814 CCCCCACCTGCTGTGTGGCCTGG - Intronic
1075067811 10:119301434-119301456 CACCCACTATGTGTGGAGACAGG - Intronic
1080052497 11:27871368-27871390 CAGCCACCAGGTCTGAGGCCAGG + Intergenic
1083235303 11:61347097-61347119 CATGCATCAGGTGTGTGTACTGG - Exonic
1083551304 11:63592053-63592075 CACCAACCAGCTGAGTGGTCTGG + Intronic
1084650569 11:70486965-70486987 CATCCCCCAGGTCTGTGGAGAGG + Intronic
1089189482 11:116643764-116643786 CACCCACCTTCTGTGTGGCCAGG - Intergenic
1089257090 11:117199740-117199762 CATCCACAAGGTGTGTGTAAGGG + Intronic
1089645482 11:119876025-119876047 CACCTTCCATGTGTCTGGACTGG + Intergenic
1090269497 11:125376175-125376197 CCTCCCCCAGGTGGGTGGACAGG - Intronic
1091312965 11:134587551-134587573 CTCCCAGCAGGTGTGAGGCCAGG - Intergenic
1091568229 12:1662865-1662887 CACCCACCAGCTGCAAGGACGGG + Intergenic
1096396349 12:51269703-51269725 CATCCACCAGGTGTCAGGAGAGG + Intronic
1096470557 12:51872730-51872752 CACCCAGCTGGTGTGTGGCAGGG - Intergenic
1096523533 12:52197520-52197542 CACTCACCAGCTGTGTGGTTTGG + Intergenic
1098206234 12:68113384-68113406 CACCAACCAGCTGTGTGTTCTGG - Intergenic
1100570007 12:95838459-95838481 CACACACCAGGTGTGTCGGGAGG - Intergenic
1103201510 12:119091686-119091708 CACCCAGCTGGTGAGTGGTCAGG + Intronic
1104586571 12:130052722-130052744 CACCTAACAGGAGTGTTGACAGG - Intergenic
1107555645 13:41515209-41515231 CACCCCCCAGCTGTGTCCACTGG - Intergenic
1112524411 13:100130508-100130530 CACTCTCGAGGTGTGGGGACAGG + Intronic
1113150010 13:107252650-107252672 CCCCCACCCCGAGTGTGGACTGG - Intronic
1113381522 13:109810180-109810202 CAACAACCACGTCTGTGGACCGG - Intergenic
1113694679 13:112336014-112336036 CACCCATCAGGAGTGTGGGCGGG - Intergenic
1114694683 14:24615474-24615496 CAGCCACTAGGTGAGTGGACCGG - Intergenic
1119225228 14:72940125-72940147 CAGCCACGAGGTGGGGGGACAGG + Intronic
1119259238 14:73227716-73227738 GACCTGCCATGTGTGTGGACAGG - Intergenic
1124096085 15:26650142-26650164 CACCCAACAGGGCTCTGGACAGG - Intronic
1124464591 15:29925412-29925434 CTGCCACCAGGTGTGTGGTGAGG + Intronic
1127632726 15:60841690-60841712 GACTGACCAGGTGTGTGGAGGGG - Intronic
1129261197 15:74368388-74368410 CACAGATCAAGTGTGTGGACAGG - Intergenic
1129869857 15:78933224-78933246 CACACACCAGGTGGGTGACCTGG + Intronic
1130964727 15:88688599-88688621 TACCCAACAGGTGATTGGACTGG - Intergenic
1132725926 16:1338352-1338374 CACCCAGCAGGTGTGGGGACAGG + Intronic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1137565475 16:49530086-49530108 CACTCACTCGCTGTGTGGACTGG + Intronic
1137621943 16:49882019-49882041 CACCTGCCAGCTGTGTGGCCTGG - Intergenic
1137764460 16:50967362-50967384 CACCCAGTAGGTCTGTGGATGGG + Intergenic
1139710180 16:68770189-68770211 CCACCACCAGGTGTGTGCTCTGG + Intronic
1139943117 16:70620420-70620442 GCCCCACCAGGTGTGAGGAGGGG + Intronic
1140976284 16:80062945-80062967 GGCCCACGAGGGGTGTGGACAGG + Intergenic
1141170168 16:81685994-81686016 CTCTCACCAGCTGTGTGGCCTGG + Intronic
1141620204 16:85233285-85233307 CACCCACCAGGTGTTTGCGTGGG + Intergenic
1141633283 16:85300812-85300834 CACACGCCAGGTGGGTGGTCGGG - Intergenic
1141896989 16:86964581-86964603 CACTTACCAGCTGTGTGGCCTGG + Intergenic
1141947859 16:87322807-87322829 CACCCACCAGGTGCCAGGCCAGG + Intronic
1142159295 16:88548329-88548351 CACCCACCAGCCCTGTGGTCTGG + Intergenic
1143368535 17:6424006-6424028 CACCACCCAGGTGTGTGGGGTGG - Exonic
1144721084 17:17470376-17470398 CACACGCCAGGTGTGGGCACCGG - Intergenic
1145778018 17:27543105-27543127 CTTCCACAGGGTGTGTGGACAGG - Intronic
1145977577 17:28993179-28993201 CACCTCCCAGGAGTGTGGCCAGG + Intronic
1146460335 17:33041119-33041141 CACCCCTCAGCTGTGTGGGCAGG - Intronic
1147140194 17:38456296-38456318 CCTCCACTGGGTGTGTGGACAGG + Intronic
1149544692 17:57494741-57494763 CATAGACCAGGTGTGTGGTCCGG - Intronic
1150473988 17:65460461-65460483 CTCCCAGCAGCTGTGGGGACAGG + Intergenic
1150607705 17:66708319-66708341 CAGCATCCAGGTGTGTGGTCCGG + Intronic
1152068480 17:78124071-78124093 CACCCACCCTGGGTGTGCACTGG + Exonic
1152743468 17:82028746-82028768 CTCCCACCAGGTGTGTGCTTTGG - Intronic
1158961250 18:62589309-62589331 CACCCCACAGGTGTGTGCAAGGG + Intergenic
1161381088 19:3965219-3965241 TGCCCAGCAGGTGTGTGGAGGGG + Intronic
1165737537 19:38186096-38186118 CACCTACTAAGTGTGTGGTCTGG - Intronic
1167748851 19:51368114-51368136 CCCCAACCCGGTGTGTGGCCAGG + Intronic
1167970379 19:53185620-53185642 CACCCACATTGGGTGTGGACAGG + Intronic
1168344804 19:55644970-55644992 CACCCGCCAGGTGAATGGAATGG - Exonic
1168344861 19:55645219-55645241 CTCTCACCAGGTGTCTGGACAGG - Exonic
1202712243 1_KI270714v1_random:24985-25007 CACCCTCTAGCTGTGTGGCCTGG - Intergenic
925454294 2:4001401-4001423 CATCCACCAGCTGTGTGAGCTGG - Intergenic
925830114 2:7885432-7885454 CATCCTCCAGGTGTGTGATCTGG + Intergenic
926062530 2:9813337-9813359 CCCCCACCAGGATGGTGGACAGG - Intergenic
929142652 2:38679728-38679750 CACACACTAGCTGTGTGGCCTGG + Intronic
930736757 2:54787441-54787463 CACTTACCAGCTGTGTGGCCTGG + Intronic
932702382 2:74000738-74000760 CACTCACCAGCTGTGTTGACAGG + Intronic
934896404 2:98123711-98123733 CAGAGACCAGGTGTGTGGACCGG + Intronic
935609062 2:105001672-105001694 GAGTCAGCAGGTGTGTGGACAGG - Intergenic
937097566 2:119245622-119245644 AGCCCACCAGGCGTGTGGCCAGG - Exonic
937969239 2:127536617-127536639 CACCCACCAGCTGTCTGACCTGG - Intronic
938818875 2:134933253-134933275 CACCCACAAAGTGTTTGCACAGG + Intronic
942597316 2:177603492-177603514 CACACACCAGGAGTGGGGTCTGG + Intergenic
948621393 2:239237086-239237108 AACCCGCCAGGTGTGCAGACAGG + Intronic
948676053 2:239597369-239597391 CACCCACCAGGAGGGTGCAGAGG + Intergenic
948825647 2:240572412-240572434 CAGCCACCAGATCTGTGGGCAGG - Exonic
948935734 2:241163209-241163231 CAGCCAGCAGGTGCCTGGACCGG - Intronic
1168895231 20:1319577-1319599 CCACCACCAGGTGAGTGGGCTGG - Exonic
1170684422 20:18556192-18556214 CACTCACCTGGTGTGTGGCCTGG + Intronic
1172216205 20:33237615-33237637 CACCCCCCAGGTGTCAGGGCAGG + Intronic
1172302247 20:33858346-33858368 CACCAGGCAGGTGTGTGGCCAGG + Intergenic
1174048010 20:47747673-47747695 CACCCACCAGGCCTGTGGCTGGG - Intronic
1174803096 20:53581585-53581607 CGCCCACCATGTCTGTGGACGGG - Exonic
1175487026 20:59353980-59354002 CACACACCAGGGGCGTGCACTGG - Intergenic
1176022171 20:62967437-62967459 CACCTTCCTGGTGTTTGGACAGG + Exonic
1176196381 20:63838068-63838090 CACACACCATGAGTGAGGACTGG + Intergenic
1176410642 21:6447854-6447876 CACCCACCAGGCCTGTGTGCAGG - Intergenic
1179686136 21:43056176-43056198 CACCCACCAGGCCTGTGTGCAGG - Intronic
1180199589 21:46216286-46216308 GGGCCACCAGGTGAGTGGACAGG + Intronic
1180844663 22:18974605-18974627 CACCCACCAGGTCTAGGGGCTGG + Intergenic
1181051693 22:20241048-20241070 CACCCACCAGGGGTAGGAACAGG + Intergenic
1181056809 22:20264106-20264128 CACCCACCAGGTCTGGGGTCTGG - Intronic
1181625190 22:24118351-24118373 CAGACATCAGGTGTGTGGCCAGG - Intronic
1183310946 22:37109274-37109296 GTGACACCAGGTGTGTGGACAGG - Intronic
1183663510 22:39234801-39234823 CCCCCACCAGGGGTGTGGAGGGG + Intronic
1185056584 22:48582005-48582027 CACGCACCCAGTGAGTGGACAGG + Intronic
1185314741 22:50174192-50174214 CACTCCCCAGGTGGGAGGACAGG + Intronic
950380385 3:12608786-12608808 TACCTACTATGTGTGTGGACTGG - Exonic
950457329 3:13100456-13100478 GACCCTCCAGGTGAGTGGAAGGG - Intergenic
953520639 3:43639357-43639379 CACCTAGCAAGGGTGTGGACGGG - Intronic
956162187 3:66366854-66366876 CCCGCACCAGCTGTGTGGCCTGG + Intronic
957150945 3:76485457-76485479 CACTCACCTGCTGTGTGGCCCGG + Intronic
964340204 3:155700234-155700256 CACCAACTAGGTCTGTGGCCAGG + Intronic
968929224 4:3569564-3569586 TAACCACCAGGTGGGAGGACTGG + Intergenic
969123139 4:4924365-4924387 CACACACCTGGTGTGTGGGGGGG - Intergenic
976921539 4:90449731-90449753 CAGGCACCAGGTGTGGGGAGAGG + Intronic
978642963 4:110893090-110893112 CACACACCAGGCGTGTTGAGGGG + Intergenic
980535750 4:134119642-134119664 CACCTACCAGGTGTGTTTGCAGG - Intergenic
981168219 4:141588496-141588518 CTCCCAGCAGGTCTATGGACAGG + Intergenic
982920361 4:161266853-161266875 CACCTTCCAGGTGCTTGGACAGG + Intergenic
983984483 4:174041710-174041732 CATCCATCTGGTGTGTTGACAGG + Intergenic
984764379 4:183388387-183388409 CACCCAGCAGTTGTGTGGGTGGG - Intergenic
985835519 5:2269356-2269378 CCACCACCAGCTGTGTGGGCTGG - Intergenic
986161201 5:5231084-5231106 CATCCTACAGGTGTGGGGACAGG - Intronic
987194386 5:15510937-15510959 CACACACCAGCTGTGTGCCCTGG - Intronic
987468327 5:18299093-18299115 CAAACACCAGGTGTGGGGAGTGG + Intergenic
989571779 5:42952133-42952155 CACTCACAAGTTGTGTGGAAGGG + Intergenic
991040932 5:62174767-62174789 CCCCCACCATGAGTGTGGGCTGG + Intergenic
992161529 5:74008661-74008683 CACCCAGCAGGTGTGCACACAGG - Intergenic
992653678 5:78887016-78887038 CACTCACTAGCTGTGTGGCCAGG + Intronic
1000156038 5:158552763-158552785 CACTTACCAGCTGTGTGGCCTGG - Intergenic
1001529543 5:172452683-172452705 CTCCCACCAGGTCTGTGAGCTGG - Intronic
1002099400 5:176849984-176850006 CTCCCACCTGCTGTGTGCACTGG + Intronic
1002484496 5:179524833-179524855 CACCCACCAGGTGTGTGGACAGG - Intergenic
1002500083 5:179642655-179642677 CACCCACCAGGTGTGTGGACAGG + Intronic
1002501888 5:179652106-179652128 CACCCACCAGGTGTGTGGACAGG - Intergenic
1003328198 6:5108723-5108745 CATTCACCAGGTGTGGGGAGGGG + Exonic
1004678182 6:17864877-17864899 AAGCCACCATGTGTGTGTACTGG + Intronic
1005246461 6:23891350-23891372 CCCCCACCAGGCTTCTGGACAGG + Intergenic
1006330176 6:33384790-33384812 CACCCTCCATCTGCGTGGACAGG - Intergenic
1006612261 6:35301222-35301244 CAGCCAGCAGGTTTTTGGACTGG - Intronic
1007612442 6:43159147-43159169 CAACCACCAAGGGTGTGCACTGG - Intronic
1010586767 6:77664509-77664531 GCCCCACCAGGTGTGAGGAGGGG + Intergenic
1010826983 6:80486394-80486416 GTCCCACCAGGTGTGAGGAGGGG + Intergenic
1011084289 6:83522028-83522050 CACCCACAGGATGTGTGCACTGG - Intronic
1014906461 6:127035289-127035311 CCCCCACCAGGAATGTGGGCTGG - Intergenic
1015176361 6:130313368-130313390 CACACACCTGGTGTATGGATCGG - Intronic
1016503415 6:144748640-144748662 CACCCATCAGGAGTCAGGACAGG + Intronic
1018849766 6:167578515-167578537 CACCCTCCTGGTAGGTGGACAGG + Intergenic
1019107696 6:169682317-169682339 CACCCAGCAGGTCTCTGCACAGG - Intronic
1019154025 6:170026754-170026776 CACCCTGCAGGCGCGTGGACAGG + Intergenic
1019154069 6:170027017-170027039 CACACCCCAGCTGTGTGGCCTGG - Intergenic
1021840810 7:24720407-24720429 GACCCAGCATGTGTGTGGTCAGG - Intronic
1023806070 7:43873954-43873976 CACCCATGAGGTTTGTGGAGAGG - Intronic
1023862478 7:44224804-44224826 CACCCACCAGCTGTGTAAATAGG - Intronic
1027540505 7:79458185-79458207 CTCCCACCATGTCTGGGGACTGG + Intergenic
1029379158 7:100201342-100201364 TCCTCACCAGGTGAGTGGACAGG + Exonic
1029574292 7:101392825-101392847 CACCTATCAGCTGTGTGGTCTGG + Intronic
1032364252 7:131284681-131284703 CTCTCACCAGGTGTGTGGCTGGG + Intronic
1032422952 7:131797863-131797885 CATCCACTAGGTTTATGGACAGG + Intergenic
1034921306 7:155084562-155084584 CACCCAACAGCCATGTGGACGGG + Exonic
1036770429 8:11575081-11575103 CACCCACCAGCCGAGAGGACTGG + Intergenic
1038087663 8:24217778-24217800 TACCCACCAGTGGTGTGGATTGG + Intergenic
1039575735 8:38622589-38622611 CACCAAACAGATGTGTGGCCGGG + Intergenic
1042496748 8:69463449-69463471 TCCCCACCAAGTGTGTGGAGGGG + Intergenic
1047126354 8:121965396-121965418 CACCCACCAGGTCTATGAATGGG - Intergenic
1047238692 8:123065419-123065441 CACCTACCATGTGTTTGGAAGGG - Intronic
1048164328 8:132048927-132048949 CACCCACAGGGTGTGTGGGTTGG + Intronic
1048342032 8:133547613-133547635 CAGCCCCCAGATGTGTGGATGGG + Intronic
1049666517 8:143845982-143846004 CCCCTCCCAGGAGTGTGGACTGG + Intergenic
1049733039 8:144188822-144188844 CACTCCCCAGGTGTATGGCCTGG - Intronic
1053803922 9:41783001-41783023 TAACCACCAGGTGGGAGGACTGG + Intergenic
1054141359 9:61532456-61532478 TAACCACCAGGTGGGAGGACTGG - Intergenic
1054192226 9:61994499-61994521 TAACCACCAGGTGGGAGGACTGG + Intergenic
1054646180 9:67594192-67594214 TAACCACCAGGTGGGAGGACTGG - Intergenic
1055127245 9:72733000-72733022 CACACACCAGGTGTGTGATTTGG - Intronic
1057170582 9:92960877-92960899 CACCCACCAGGAGAGAGGCCCGG - Intronic
1058626848 9:106942364-106942386 CACAGAACAGGTGTGTGGCCAGG - Intronic
1059247516 9:112861464-112861486 CACTTACCAGGTGTGTGGCCTGG - Intronic
1059465311 9:114465700-114465722 AACCCACCAGTTGTGTGGCCTGG + Intronic
1060545067 9:124454654-124454676 CACCCACCTGGTGTGTCTGCAGG + Intronic
1061225501 9:129278785-129278807 CACCCACCAGGTGGGGGAAATGG - Intergenic
1061923879 9:133796669-133796691 CACACACCTGGTGCATGGACTGG - Intronic
1061923881 9:133796675-133796697 CATGCACCAGGTGTGTGCAGAGG + Intronic
1062011141 9:134267501-134267523 GAGCCAGCAGGTGTGTGGGCCGG + Intergenic
1062129610 9:134885414-134885436 CTCCCACCAGGTGTGCAGCCTGG - Intronic
1062377332 9:136268036-136268058 CACCCACCAGGTACGTGGAGAGG - Intergenic
1196195287 X:112832853-112832875 CATCCAGCAGGTGTATGGACAGG + Intronic
1200094508 X:153650829-153650851 AGCCCACCAGATGTGTGGCCGGG - Exonic