ID: 1002500376

View in Genome Browser
Species Human (GRCh38)
Location 5:179643897-179643919
Sequence CGGGTTCCAATTGCCCTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002500364_1002500376 23 Left 1002500364 5:179643851-179643873 CCTGGACCCCATGGCTTCAACTC 0: 1
1: 0
2: 2
3: 19
4: 347
Right 1002500376 5:179643897-179643919 CGGGTTCCAATTGCCCTACCAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1002500362_1002500376 29 Left 1002500362 5:179643845-179643867 CCGCTCCCTGGACCCCATGGCTT 0: 1
1: 0
2: 5
3: 32
4: 373
Right 1002500376 5:179643897-179643919 CGGGTTCCAATTGCCCTACCAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1002500369_1002500376 15 Left 1002500369 5:179643859-179643881 CCATGGCTTCAACTCAGCAGGGA 0: 1
1: 0
2: 1
3: 20
4: 211
Right 1002500376 5:179643897-179643919 CGGGTTCCAATTGCCCTACCAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1002500367_1002500376 16 Left 1002500367 5:179643858-179643880 CCCATGGCTTCAACTCAGCAGGG 0: 1
1: 0
2: 1
3: 16
4: 139
Right 1002500376 5:179643897-179643919 CGGGTTCCAATTGCCCTACCAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1002500365_1002500376 17 Left 1002500365 5:179643857-179643879 CCCCATGGCTTCAACTCAGCAGG 0: 1
1: 0
2: 1
3: 16
4: 176
Right 1002500376 5:179643897-179643919 CGGGTTCCAATTGCCCTACCAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1002500363_1002500376 24 Left 1002500363 5:179643850-179643872 CCCTGGACCCCATGGCTTCAACT 0: 1
1: 0
2: 1
3: 13
4: 205
Right 1002500376 5:179643897-179643919 CGGGTTCCAATTGCCCTACCAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1002500361_1002500376 30 Left 1002500361 5:179643844-179643866 CCCGCTCCCTGGACCCCATGGCT 0: 1
1: 1
2: 1
3: 32
4: 450
Right 1002500376 5:179643897-179643919 CGGGTTCCAATTGCCCTACCAGG 0: 1
1: 0
2: 0
3: 1
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002500376 Original CRISPR CGGGTTCCAATTGCCCTACC AGG Intronic
901196556 1:7443551-7443573 TGGGTTCCCAGTGCCCTAGCAGG - Intronic
907213641 1:52843503-52843525 CGGGTTCCAGTTCCCCCAGCCGG - Intronic
1083999001 11:66285889-66285911 CTGCTTCCAAATGCCCTGCCTGG + Intronic
1097079916 12:56422394-56422416 AGGGTTCCATTGGCCCAACCTGG - Intronic
1099358531 12:81668200-81668222 CTGGATCCCATTGCCCTAGCAGG + Intronic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1113973032 13:114205186-114205208 AGGGTTCCAATTTCCCCACATGG - Intergenic
1114775834 14:25480253-25480275 TGGGTTTCAATTACCCTCCCAGG + Intergenic
1123477145 15:20598081-20598103 CGGGTTCTGATTTCCCTCCCAGG + Intergenic
1123640868 15:22402283-22402305 CGGGTTCTGATTTCCCTCCCAGG - Intergenic
1125743699 15:41984905-41984927 CTGGTTCCAGTCGCCCTTCCAGG - Intronic
1129606548 15:77027993-77028015 CCTGTTCCAAATGCCCTGCCCGG - Intronic
1132517067 16:370735-370757 CGGGCCCCACTTACCCTACCCGG + Intergenic
1139072126 16:63395236-63395258 GGGGATCCAATTGCCCTACATGG - Intergenic
1145941276 17:28744455-28744477 CGGGTCCCAACTGCCCGGCCCGG + Intronic
1152229163 17:79106108-79106130 CCGGTTCCAAGTTCCCCACCTGG + Intronic
1157578334 18:48758649-48758671 CTGGTTCCAAGTGCCCACCCTGG - Intronic
1160199615 18:76785700-76785722 CGTGATCCAATTGCCCTCCTAGG + Intergenic
1167489380 19:49782721-49782743 CGGGTCCCCAGTGCCTTACCCGG - Exonic
936107582 2:109638408-109638430 CAGGTTCCAAATTCCCCACCAGG + Intergenic
942183257 2:173400942-173400964 CAGGTTCCCTTTGCCCTACAGGG + Intergenic
944111126 2:196132050-196132072 CAGCCTCCAATTGCCCAACCAGG - Intergenic
1174358730 20:50015128-50015150 CTGCTTCCCATTGCCCTACGCGG - Intergenic
1182106705 22:27694941-27694963 CAGGTTCCAAATGCCCCTCCCGG + Intergenic
963263978 3:143220971-143220993 TGGGTTCAACTTGCCCTTCCAGG - Intergenic
968717971 4:2175846-2175868 CTGGTTCCCTTTGCCCTCCCTGG + Intronic
997629771 5:135358275-135358297 AGGGTTCCAACTGCCCTTTCTGG - Intronic
1002484187 5:179523584-179523606 CGGGTTCCAATTTCTCTCCTAGG - Intergenic
1002500376 5:179643897-179643919 CGGGTTCCAATTGCCCTACCAGG + Intronic
1004872363 6:19919802-19919824 TAGGTTCCCATAGCCCTACCTGG - Intergenic
1028922645 7:96324084-96324106 TGGGTTCCAACTGAACTACCAGG + Intergenic
1030366705 7:108654964-108654986 CTGGTTCCAATTGCTCTTCAAGG - Intergenic
1040738391 8:50539720-50539742 CAGGCTCCAATTTCCCTGCCAGG - Intronic
1049983619 9:927680-927702 CAGGTTCCAAATGCGCTTCCTGG + Intronic
1062426678 9:136509215-136509237 CGGGTTCCCACTGGCCTCCCTGG - Intronic
1196603943 X:117634158-117634180 TGGGTTCCATTTGCCCTATATGG + Intergenic
1197770843 X:130088291-130088313 CTGGTTCCAGCTACCCTACCTGG - Intronic