ID: 1002501229

View in Genome Browser
Species Human (GRCh38)
Location 5:179648959-179648981
Sequence CTGTGGGACTGGAGAGCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002501229_1002501236 1 Left 1002501229 5:179648959-179648981 CCGTCTGCTCTCCAGTCCCACAG No data
Right 1002501236 5:179648983-179649005 GGCTGCTGTCAGTCACCCTACGG No data
1002501229_1002501237 15 Left 1002501229 5:179648959-179648981 CCGTCTGCTCTCCAGTCCCACAG No data
Right 1002501237 5:179648997-179649019 ACCCTACGGCCTCTCTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002501229 Original CRISPR CTGTGGGACTGGAGAGCAGA CGG (reversed) Intergenic
No off target data available for this crispr