ID: 1002501880

View in Genome Browser
Species Human (GRCh38)
Location 5:179652080-179652102
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002501880_1002501892 29 Left 1002501880 5:179652080-179652102 CCCAATGTGCAAGGCCCCTGAGC No data
Right 1002501892 5:179652132-179652154 TCTAGCCCTCGAGTGATCCGAGG No data
1002501880_1002501885 -3 Left 1002501880 5:179652080-179652102 CCCAATGTGCAAGGCCCCTGAGC No data
Right 1002501885 5:179652100-179652122 AGCGCTCCTGTCCACACACCTGG No data
1002501880_1002501886 0 Left 1002501880 5:179652080-179652102 CCCAATGTGCAAGGCCCCTGAGC No data
Right 1002501886 5:179652103-179652125 GCTCCTGTCCACACACCTGGTGG No data
1002501880_1002501887 1 Left 1002501880 5:179652080-179652102 CCCAATGTGCAAGGCCCCTGAGC No data
Right 1002501887 5:179652104-179652126 CTCCTGTCCACACACCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002501880 Original CRISPR GCTCAGGGGCCTTGCACATT GGG (reversed) Intergenic