ID: 1002501881

View in Genome Browser
Species Human (GRCh38)
Location 5:179652081-179652103
Sequence CGCTCAGGGGCCTTGCACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002501881_1002501887 0 Left 1002501881 5:179652081-179652103 CCAATGTGCAAGGCCCCTGAGCG No data
Right 1002501887 5:179652104-179652126 CTCCTGTCCACACACCTGGTGGG No data
1002501881_1002501892 28 Left 1002501881 5:179652081-179652103 CCAATGTGCAAGGCCCCTGAGCG No data
Right 1002501892 5:179652132-179652154 TCTAGCCCTCGAGTGATCCGAGG No data
1002501881_1002501886 -1 Left 1002501881 5:179652081-179652103 CCAATGTGCAAGGCCCCTGAGCG No data
Right 1002501886 5:179652103-179652125 GCTCCTGTCCACACACCTGGTGG No data
1002501881_1002501885 -4 Left 1002501881 5:179652081-179652103 CCAATGTGCAAGGCCCCTGAGCG No data
Right 1002501885 5:179652100-179652122 AGCGCTCCTGTCCACACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002501881 Original CRISPR CGCTCAGGGGCCTTGCACAT TGG (reversed) Intergenic