ID: 1002501883

View in Genome Browser
Species Human (GRCh38)
Location 5:179652095-179652117
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002501883_1002501895 20 Left 1002501883 5:179652095-179652117 CCCTGAGCGCTCCTGTCCACACA No data
Right 1002501895 5:179652138-179652160 CCTCGAGTGATCCGAGGCGTTGG No data
1002501883_1002501892 14 Left 1002501883 5:179652095-179652117 CCCTGAGCGCTCCTGTCCACACA No data
Right 1002501892 5:179652132-179652154 TCTAGCCCTCGAGTGATCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002501883 Original CRISPR TGTGTGGACAGGAGCGCTCA GGG (reversed) Intergenic