ID: 1002501884

View in Genome Browser
Species Human (GRCh38)
Location 5:179652096-179652118
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002501884_1002501892 13 Left 1002501884 5:179652096-179652118 CCTGAGCGCTCCTGTCCACACAC No data
Right 1002501892 5:179652132-179652154 TCTAGCCCTCGAGTGATCCGAGG No data
1002501884_1002501895 19 Left 1002501884 5:179652096-179652118 CCTGAGCGCTCCTGTCCACACAC No data
Right 1002501895 5:179652138-179652160 CCTCGAGTGATCCGAGGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002501884 Original CRISPR GTGTGTGGACAGGAGCGCTC AGG (reversed) Intergenic