ID: 1002501888

View in Genome Browser
Species Human (GRCh38)
Location 5:179652106-179652128
Sequence CACCCACCAGGTGTGTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002501888_1002501892 3 Left 1002501888 5:179652106-179652128 CCTGTCCACACACCTGGTGGGTG No data
Right 1002501892 5:179652132-179652154 TCTAGCCCTCGAGTGATCCGAGG No data
1002501888_1002501895 9 Left 1002501888 5:179652106-179652128 CCTGTCCACACACCTGGTGGGTG No data
Right 1002501895 5:179652138-179652160 CCTCGAGTGATCCGAGGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002501888 Original CRISPR CACCCACCAGGTGTGTGGAC AGG (reversed) Intergenic
No off target data available for this crispr