ID: 1002501889

View in Genome Browser
Species Human (GRCh38)
Location 5:179652111-179652133
Sequence GAAGGCACCCACCAGGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002501889_1002501898 28 Left 1002501889 5:179652111-179652133 CCACACACCTGGTGGGTGCCTTC No data
Right 1002501898 5:179652162-179652184 CGCTGCAGTGATCCCAACCTGGG No data
1002501889_1002501897 27 Left 1002501889 5:179652111-179652133 CCACACACCTGGTGGGTGCCTTC No data
Right 1002501897 5:179652161-179652183 TCGCTGCAGTGATCCCAACCTGG No data
1002501889_1002501895 4 Left 1002501889 5:179652111-179652133 CCACACACCTGGTGGGTGCCTTC No data
Right 1002501895 5:179652138-179652160 CCTCGAGTGATCCGAGGCGTTGG No data
1002501889_1002501892 -2 Left 1002501889 5:179652111-179652133 CCACACACCTGGTGGGTGCCTTC No data
Right 1002501892 5:179652132-179652154 TCTAGCCCTCGAGTGATCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002501889 Original CRISPR GAAGGCACCCACCAGGTGTG TGG (reversed) Intergenic