ID: 1002501890

View in Genome Browser
Species Human (GRCh38)
Location 5:179652118-179652140
Sequence AGGGCTAGAAGGCACCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002501890_1002501895 -3 Left 1002501890 5:179652118-179652140 CCTGGTGGGTGCCTTCTAGCCCT No data
Right 1002501895 5:179652138-179652160 CCTCGAGTGATCCGAGGCGTTGG No data
1002501890_1002501892 -9 Left 1002501890 5:179652118-179652140 CCTGGTGGGTGCCTTCTAGCCCT No data
Right 1002501892 5:179652132-179652154 TCTAGCCCTCGAGTGATCCGAGG No data
1002501890_1002501897 20 Left 1002501890 5:179652118-179652140 CCTGGTGGGTGCCTTCTAGCCCT No data
Right 1002501897 5:179652161-179652183 TCGCTGCAGTGATCCCAACCTGG No data
1002501890_1002501898 21 Left 1002501890 5:179652118-179652140 CCTGGTGGGTGCCTTCTAGCCCT No data
Right 1002501898 5:179652162-179652184 CGCTGCAGTGATCCCAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002501890 Original CRISPR AGGGCTAGAAGGCACCCACC AGG (reversed) Intergenic