ID: 1002501895

View in Genome Browser
Species Human (GRCh38)
Location 5:179652138-179652160
Sequence CCTCGAGTGATCCGAGGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002501883_1002501895 20 Left 1002501883 5:179652095-179652117 CCCTGAGCGCTCCTGTCCACACA No data
Right 1002501895 5:179652138-179652160 CCTCGAGTGATCCGAGGCGTTGG No data
1002501884_1002501895 19 Left 1002501884 5:179652096-179652118 CCTGAGCGCTCCTGTCCACACAC No data
Right 1002501895 5:179652138-179652160 CCTCGAGTGATCCGAGGCGTTGG No data
1002501882_1002501895 21 Left 1002501882 5:179652094-179652116 CCCCTGAGCGCTCCTGTCCACAC No data
Right 1002501895 5:179652138-179652160 CCTCGAGTGATCCGAGGCGTTGG No data
1002501890_1002501895 -3 Left 1002501890 5:179652118-179652140 CCTGGTGGGTGCCTTCTAGCCCT No data
Right 1002501895 5:179652138-179652160 CCTCGAGTGATCCGAGGCGTTGG No data
1002501889_1002501895 4 Left 1002501889 5:179652111-179652133 CCACACACCTGGTGGGTGCCTTC No data
Right 1002501895 5:179652138-179652160 CCTCGAGTGATCCGAGGCGTTGG No data
1002501888_1002501895 9 Left 1002501888 5:179652106-179652128 CCTGTCCACACACCTGGTGGGTG No data
Right 1002501895 5:179652138-179652160 CCTCGAGTGATCCGAGGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002501895 Original CRISPR CCTCGAGTGATCCGAGGCGT TGG Intergenic
No off target data available for this crispr