ID: 1002506375

View in Genome Browser
Species Human (GRCh38)
Location 5:179681970-179681992
Sequence CAGGCATGAAACATCGCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87863
Summary {0: 1, 1: 17, 2: 698, 3: 12492, 4: 74655}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002506375_1002506383 5 Left 1002506375 5:179681970-179681992 CCAGGCGCGATGTTTCATGCCTG 0: 1
1: 17
2: 698
3: 12492
4: 74655
Right 1002506383 5:179681998-179682020 CCCAGCACTTTGGGAGGGGAAGG No data
1002506375_1002506376 -5 Left 1002506375 5:179681970-179681992 CCAGGCGCGATGTTTCATGCCTG 0: 1
1: 17
2: 698
3: 12492
4: 74655
Right 1002506376 5:179681988-179682010 GCCTGTAAATCCCAGCACTTTGG 0: 323
1: 792
2: 1065
3: 1575
4: 4033
1002506375_1002506385 8 Left 1002506375 5:179681970-179681992 CCAGGCGCGATGTTTCATGCCTG 0: 1
1: 17
2: 698
3: 12492
4: 74655
Right 1002506385 5:179682001-179682023 AGCACTTTGGGAGGGGAAGGTGG 0: 3
1: 703
2: 64636
3: 219379
4: 147939
1002506375_1002506386 9 Left 1002506375 5:179681970-179681992 CCAGGCGCGATGTTTCATGCCTG 0: 1
1: 17
2: 698
3: 12492
4: 74655
Right 1002506386 5:179682002-179682024 GCACTTTGGGAGGGGAAGGTGGG No data
1002506375_1002506387 12 Left 1002506375 5:179681970-179681992 CCAGGCGCGATGTTTCATGCCTG 0: 1
1: 17
2: 698
3: 12492
4: 74655
Right 1002506387 5:179682005-179682027 CTTTGGGAGGGGAAGGTGGGTGG No data
1002506375_1002506381 1 Left 1002506375 5:179681970-179681992 CCAGGCGCGATGTTTCATGCCTG 0: 1
1: 17
2: 698
3: 12492
4: 74655
Right 1002506381 5:179681994-179682016 AAATCCCAGCACTTTGGGAGGGG 0: 6
1: 185
2: 271
3: 439
4: 776
1002506375_1002506379 -1 Left 1002506375 5:179681970-179681992 CCAGGCGCGATGTTTCATGCCTG 0: 1
1: 17
2: 698
3: 12492
4: 74655
Right 1002506379 5:179681992-179682014 GTAAATCCCAGCACTTTGGGAGG 0: 415
1: 1042
2: 7646
3: 340289
4: 269048
1002506375_1002506380 0 Left 1002506375 5:179681970-179681992 CCAGGCGCGATGTTTCATGCCTG 0: 1
1: 17
2: 698
3: 12492
4: 74655
Right 1002506380 5:179681993-179682015 TAAATCCCAGCACTTTGGGAGGG 0: 6
1: 68
2: 2791
3: 3481
4: 3526
1002506375_1002506378 -4 Left 1002506375 5:179681970-179681992 CCAGGCGCGATGTTTCATGCCTG 0: 1
1: 17
2: 698
3: 12492
4: 74655
Right 1002506378 5:179681989-179682011 CCTGTAAATCCCAGCACTTTGGG 0: 410
1: 921
2: 1236
3: 2738
4: 26902

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002506375 Original CRISPR CAGGCATGAAACATCGCGCC TGG (reversed) Intronic
Too many off-targets to display for this crispr