ID: 1002506387

View in Genome Browser
Species Human (GRCh38)
Location 5:179682005-179682027
Sequence CTTTGGGAGGGGAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002506377_1002506387 -7 Left 1002506377 5:179681989-179682011 CCTGTAAATCCCAGCACTTTGGG 0: 397
1: 895
2: 1315
3: 5899
4: 5416
Right 1002506387 5:179682005-179682027 CTTTGGGAGGGGAAGGTGGGTGG No data
1002506375_1002506387 12 Left 1002506375 5:179681970-179681992 CCAGGCGCGATGTTTCATGCCTG 0: 1
1: 17
2: 698
3: 12492
4: 74655
Right 1002506387 5:179682005-179682027 CTTTGGGAGGGGAAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002506387 Original CRISPR CTTTGGGAGGGGAAGGTGGG TGG Intronic
No off target data available for this crispr