ID: 1002508115

View in Genome Browser
Species Human (GRCh38)
Location 5:179694662-179694684
Sequence AAGTCGAAAGGGAAGTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 5, 2: 8, 3: 25, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002508115 Original CRISPR AAGTCGAAAGGGAAGTTTGA TGG Intronic
901600020 1:10416287-10416309 AATTCAAAAGGGAGTTTTGAGGG - Intronic
907555480 1:55339998-55340020 CATTAGAAAGGGAAGTCTGAAGG - Intergenic
907832421 1:58077721-58077743 AAGGAGAAAGGAAAGATTGACGG + Intronic
909024824 1:70469611-70469633 AAGTCCAAAGGGAAGTCTGATGG - Intergenic
909295806 1:73947175-73947197 AAGTCCAAAGGTCAGTTTCAGGG + Intergenic
909797276 1:79757098-79757120 AAGACGCAAGGGAAGTGTGGTGG - Intergenic
910684394 1:89901530-89901552 AGGTGGAAAGGGAAGTATGAAGG - Intronic
912678794 1:111714337-111714359 AAGTTTAAAGGTATGTTTGAGGG - Exonic
913229641 1:116731034-116731056 AAATCAAAAGTGAAGTTTGAAGG - Intergenic
916393315 1:164357246-164357268 AAGTCGAAAGGAAAGTTTGATGG + Intergenic
917167318 1:172127103-172127125 AAGTTGGAAGGGAGGCTTGAAGG - Intronic
917238214 1:172917523-172917545 GAGTCTAAAGAGAAGCTTGAAGG + Intergenic
917981659 1:180273164-180273186 AAATAGAAAAGGAAGTTTGTGGG + Intronic
923302384 1:232653400-232653422 AAGTGCAAGGGGAAGTTTGGAGG + Intergenic
924441776 1:244092166-244092188 AATTGGAAAGGTAAGATTGAGGG + Intergenic
1062977721 10:1697830-1697852 AAGTCGAAAGAGAAGTTGCAGGG - Intronic
1064593624 10:16921003-16921025 ATTTTGCAAGGGAAGTTTGAAGG - Intronic
1064977822 10:21136630-21136652 AAGGCAAAAGGGAACTTGGAAGG - Intronic
1065174562 10:23064038-23064060 AAGTCGAAAGGTCATTTTGTTGG + Intergenic
1069087357 10:64156824-64156846 AAGTCAAAAGGGAAGGAAGATGG + Intergenic
1069509821 10:69033803-69033825 ATGAAGAAAGGGAAGTTTGAAGG - Intergenic
1069757931 10:70785205-70785227 AGGTAGAAAGGGAAGTTTTGTGG - Intronic
1070833682 10:79435292-79435314 AAGAGGAAGGGGAAGTTTGGTGG + Intronic
1074115111 10:110451124-110451146 AAGTCGAAAGGAAAGTTTGATGG + Intergenic
1074166479 10:110881468-110881490 CAGTCCAAAGGGAAGGTTGCTGG + Exonic
1074736470 10:116439548-116439570 AAGTCGAAAGTAAAGTTTGATGG - Intronic
1080760088 11:35240323-35240345 AAGGAGAAAGGGAAGGTTGTGGG + Intergenic
1081498302 11:43638572-43638594 AAACGGAAAGGGAAGTTTGGGGG + Intronic
1082187015 11:49195405-49195427 AAGTGGAAAGGGAAGTTAAAGGG + Intronic
1083349786 11:62019322-62019344 GAGACAAAAGGGAAGTGTGAGGG + Intergenic
1083588265 11:63876228-63876250 AAGTTGAAGGCTAAGTTTGAAGG - Intronic
1086170582 11:83831917-83831939 AAGAGGAAAGGGAAATTAGAAGG + Intronic
1086679323 11:89649977-89649999 AAGTGGAAAGGGAAGTTAAAGGG - Intergenic
1087549089 11:99624042-99624064 AAGTTAACAGGGAAATTTGATGG + Intronic
1088197062 11:107286247-107286269 AATTTGAAAGGCAAGATTGATGG + Intergenic
1090267372 11:125361791-125361813 AAGTCTGAAGGGAAGTTGGCAGG + Intronic
1091951452 12:4596375-4596397 AAGACAAAAGGGAAGATTGGAGG - Intronic
1092041400 12:5388315-5388337 AAGTTTAAATGGAACTTTGATGG + Intergenic
1092748646 12:11697374-11697396 AAGTTGAAAGGGAAGGTTAAGGG + Intronic
1099826862 12:87787038-87787060 AACTATAAAGGGAATTTTGATGG + Intergenic
1101027031 12:100619174-100619196 AAGTTGTGAGGGAAGATTGATGG + Intronic
1104222277 12:126796582-126796604 AAGGAGAAAGGGAGGTTGGAAGG - Intergenic
1108506397 13:51116321-51116343 AAGTTGGAAGGGAAGGGTGAAGG + Intergenic
1109168555 13:59066633-59066655 AAGTTGATAAGGAAGTTTGGAGG + Intergenic
1109263365 13:60169028-60169050 AAGTGGAAAGGCAAGGTGGAGGG - Intergenic
1109988634 13:70023637-70023659 AACAAGAAAGGAAAGTTTGAAGG - Intronic
1112684041 13:101802332-101802354 AAGTGTAAAGGAGAGTTTGATGG + Intronic
1112703833 13:102043554-102043576 AACTCTAAAGGCAGGTTTGAGGG + Intronic
1113886382 13:113661249-113661271 GAGTCAAAAAGGAAGTTTCAAGG + Intergenic
1118039430 14:61901039-61901061 AAGTCAGAAGGGAAATTGGAAGG - Intergenic
1119446448 14:74668247-74668269 AACTCCTAAGGGAACTTTGAAGG + Intronic
1119611220 14:76064172-76064194 AAGTCTAAAAGGAAGTTAGTGGG - Intronic
1119906380 14:78306492-78306514 AATTCGAAAGAGTAGTCTGATGG + Intronic
1120110625 14:80551133-80551155 AAGTCAAAAGAGAACTTTGTAGG - Intronic
1120336748 14:83167314-83167336 AAATAGAAATAGAAGTTTGAGGG + Intergenic
1122389947 14:101373381-101373403 CAGCAGAAAGGGAAGTTGGAGGG - Intergenic
1122670014 14:103364327-103364349 AAGTCTAAAGGAAACTTTGATGG - Intergenic
1122931754 14:104936344-104936366 AAGTGGGAAGGGAAATTTGGTGG - Exonic
1124973730 15:34514726-34514748 AAGGCCAAAGGGAAGTTTCTGGG - Intergenic
1130445613 15:83998589-83998611 AAGTAGAAAGGGTACTTTGAGGG + Intronic
1131306873 15:91252747-91252769 AAGGAGAAAGGGAAGAATGAAGG - Intronic
1134118535 16:11567476-11567498 AGGTTGAAAGGGAAGTGTGGGGG + Intronic
1136748878 16:32615473-32615495 AAGTGGAAGCGGAAGTGTGAGGG + Intergenic
1138525466 16:57603611-57603633 AAGTCTGAAGGAAAGTTCGATGG + Intergenic
1140708687 16:77656155-77656177 AAGTAGAAAGGGAAGTTGAAGGG + Intergenic
1203051011 16_KI270728v1_random:874687-874709 AAGTGGAAGCGGAAGTGTGAGGG + Intergenic
1143595201 17:7909792-7909814 AAGGTCAAAGGGAAGTTTCATGG - Intronic
1147737380 17:42648655-42648677 AAGTCGAAAGGAAAGTCTGATGG + Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1150703855 17:67470351-67470373 AAGTCACAAGGGAAGTTCTAGGG - Intronic
1150980382 17:70134977-70134999 AAGGAGAAAGGGAAGGATGAGGG - Exonic
1152346025 17:79752358-79752380 AACCCGAAGGGGAAGTTTGCTGG - Intergenic
1154220677 18:12450923-12450945 AAGTTGAAAGGAAAGTTTGATGG + Intronic
1156624258 18:38889395-38889417 CAGTAGGAAGGGAAGTTGGATGG - Intergenic
1156648259 18:39193899-39193921 AAGTAAAAAGGGAAGTTTGGTGG - Intergenic
1157846639 18:51009565-51009587 AAGCAGAAAAGGAAGTTGGAAGG - Intronic
1159615637 18:70576247-70576269 AAGGCCAAAGGAAAGTTTCAGGG - Intergenic
1163457584 19:17417086-17417108 AAGTTGAAAGGAAAGTTTGACGG - Intronic
1166147201 19:40845896-40845918 CAGTCGAAGGGGAATTTTGAGGG + Intronic
1166151358 19:40877792-40877814 CAGTCGAAGGGGAATTTTGAGGG + Intronic
1167639425 19:50672587-50672609 AAGGCGAAAGGGAATTCTGCGGG + Intronic
928818835 2:35335221-35335243 AAGCAAAAAGGGAGGTTTGAAGG - Intergenic
931452735 2:62381955-62381977 AACTTCAAAAGGAAGTTTGATGG + Intergenic
931508805 2:62964821-62964843 AACTCGAAAGGGAAAATTAACGG - Intronic
932190954 2:69741592-69741614 AAGTAGAAAGTGAAATCTGAAGG - Intronic
932210805 2:69928357-69928379 AAGTCAGATGGGATGTTTGAGGG + Intronic
932437288 2:71710004-71710026 AAGTCAAAGGGGAAGATGGAGGG - Intergenic
935582685 2:104771764-104771786 AAGTTGAAAGGAAAGTTTGATGG + Intergenic
935744923 2:106182066-106182088 AATGCGAAAGAGAAATTTGATGG + Intronic
935945384 2:108281505-108281527 AAGTGTAAAGGGTAATTTGATGG - Intergenic
937253366 2:120538177-120538199 AAGACCAAGGGGAAGTTTGTTGG - Intergenic
940388360 2:153101386-153101408 AAGTAGAAAGGAAACTTTCAAGG + Intergenic
944923364 2:204438112-204438134 AAGTCAAGAGGGAAGTTGAAAGG + Intergenic
1169560079 20:6790395-6790417 AAGTCTCAAGGGAAGTGGGAAGG + Intergenic
1169943363 20:10962083-10962105 AAAGAGAAAGGGCAGTTTGATGG - Intergenic
1171167287 20:22983115-22983137 TAGTAGAAAGAGAATTTTGAGGG - Intergenic
1172422999 20:34833660-34833682 AAGTCGAAAGGAAAGTTGGACGG - Intergenic
1172584867 20:36076097-36076119 AAGGCAAAAGGAAAGTTTGATGG - Intergenic
1173742151 20:45408403-45408425 AAGTCGAAAGAGAAGACAGAGGG - Exonic
1173914435 20:46696430-46696452 AAGTAGAAGGGGGAGTTTCACGG - Intergenic
1175093251 20:56521962-56521984 AAGTCGGCTGGGAAGTTTGGTGG - Intronic
1177741528 21:25159782-25159804 AAGGCTACAGGGAAGTTTGAGGG - Intergenic
1179244852 21:39624058-39624080 AAGTGGAATGGCAAGTCTGAAGG + Intronic
1180699942 22:17775794-17775816 AAGACGAAAGGGAAACTTCATGG + Intergenic
1180892077 22:19296736-19296758 AAGCTGAAAGGGAAGTCAGAAGG + Intergenic
1182990045 22:34759012-34759034 AATTCGAAAGGGCAGAATGATGG + Intergenic
1184431461 22:44443542-44443564 GATTCTAAAGGGAAGTTTCATGG - Intergenic
949367531 3:3299332-3299354 AAATCTAAAGGGCAGTTGGAAGG - Intergenic
949706321 3:6821893-6821915 AATTCAAAAGAGAAGTTAGAGGG - Intronic
949797042 3:7862776-7862798 AAGCTGAAAGGGTAGCTTGAAGG + Intergenic
950532737 3:13562149-13562171 AAGCCAAAAGGGAAATTAGAGGG - Intronic
951767603 3:26216797-26216819 AAGTCTAAAGGAAAGTTTGGTGG + Intergenic
952259098 3:31722121-31722143 AAGTCTCAAGGGTATTTTGAGGG - Intronic
952462105 3:33538445-33538467 AAATCTAAAAGGAAATTTGAAGG + Intronic
952775893 3:37046168-37046190 AAATCAAAAGGGAAATTAGAAGG - Intronic
954957155 3:54531341-54531363 AAGTTGATAGGGAAGTATGACGG + Intronic
956952603 3:74299458-74299480 AAGTCATAAGGGGAGCTTGAGGG + Intronic
957828901 3:85489189-85489211 AAGTTGAAATTGAAGTCTGAAGG + Intronic
958602858 3:96321036-96321058 AAGTAGAAAGGGACTGTTGATGG + Intergenic
958691038 3:97466492-97466514 AAGTCAAAGGGGTAGTGTGAGGG + Intronic
960165206 3:114393700-114393722 AAGTCAAAAGATAATTTTGAGGG + Intronic
960690699 3:120343051-120343073 AAGTGGACAGGGAAGGTAGACGG + Intronic
962294592 3:134170972-134170994 AAGTCTAAAGGAAAATCTGATGG + Intronic
962480553 3:135794462-135794484 TAGTGGATAGGTAAGTTTGAAGG - Intergenic
963235875 3:142955350-142955372 ATGTGGAAAGTGAAGTTTCAAGG + Intronic
964233564 3:154498598-154498620 AACTCGAAATGCAAGTTAGAAGG - Intergenic
964270901 3:154955587-154955609 TAGTCCAAAGGAAAGTTGGATGG - Intergenic
964948303 3:162254187-162254209 AAATGGGAAGGGAACTTTGAGGG + Intergenic
968152764 3:196351694-196351716 AAGAAGAAAGAGAAGTGTGAAGG + Exonic
970502189 4:16689382-16689404 AAGTCTAAAGGGAGGGTTCATGG - Intronic
971076401 4:23154015-23154037 AAGAGGGCAGGGAAGTTTGAGGG - Intergenic
971835439 4:31757119-31757141 AAGTGGATAGGGATTTTTGAGGG - Intergenic
972006923 4:34121070-34121092 AAATAGAAAGGTAAGTTTGCAGG - Intergenic
972722581 4:41715166-41715188 ATTTTGAAAGGGTAGTTTGAAGG - Intergenic
976765087 4:88591386-88591408 AAGTAGAAAAGAAAGTTTCAAGG - Intronic
977405195 4:96588965-96588987 ATGTCGAACAAGAAGTTTGAAGG - Intergenic
978076619 4:104539175-104539197 AAGGAGAAAGGGAAATTTGCCGG + Intergenic
979598377 4:122559150-122559172 AATTGGAAAGGGAAGGCTGAAGG + Intergenic
982973039 4:162015278-162015300 AAGAAAAAAGGGAAGTGTGACGG + Intronic
983122500 4:163904413-163904435 AAGTAGATAGGGAATTTTAATGG + Intronic
983293763 4:165839614-165839636 AAGTGGAAAGGGGATTTGGAAGG - Intergenic
984103774 4:175518332-175518354 AAGAAGAAAGAGAAGTTAGAAGG - Intergenic
984865863 4:184280074-184280096 AACTGAAAAGGGAAGTTGGAGGG + Intergenic
984876740 4:184375417-184375439 AAGAAGAAAAGGAAGTTAGAAGG - Intergenic
987382526 5:17298926-17298948 AAGTGGAAAGAGAAATTGGAAGG + Intergenic
988330383 5:29830798-29830820 AAGACAAAAGAGAATTTTGAAGG + Intergenic
988788218 5:34583741-34583763 AAGCCCGAAGGGAAGTTTGAGGG - Intergenic
990214733 5:53517643-53517665 AAGTCAAAAAGGAACTTTGAGGG + Intergenic
992630033 5:78670811-78670833 AAATAGAAAGGGCAGCTTGATGG + Intronic
994664925 5:102694842-102694864 AAGTAGAAAAGGGAGTTTGTGGG - Intergenic
994686685 5:102963467-102963489 AAGTGATAAGTGAAGTTTGAGGG - Intronic
995466315 5:112452792-112452814 AGGTCTAAAGGAAAGTTTGATGG - Intergenic
995733609 5:115273441-115273463 AGGAGGAAAGGGAAGTTTGGAGG - Intronic
995970865 5:117969157-117969179 AAGAAGAAAGGAAAGTTTCAAGG + Intergenic
996439046 5:123468874-123468896 AAGCATAAAGGAAAGTTTGATGG - Intergenic
998382545 5:141735966-141735988 AGGAGGAAAGGGAAGTTGGAGGG - Intergenic
1002508115 5:179694662-179694684 AAGTCGAAAGGGAAGTTTGATGG + Intronic
1003817245 6:9855450-9855472 AAGTGGAAACTAAAGTTTGACGG - Intronic
1004740180 6:18452413-18452435 AAGAAGAAAGGGAATTTTTAGGG + Intronic
1005010358 6:21330041-21330063 AAGACTACAGGGAAGTTGGAGGG + Intergenic
1005566240 6:27097431-27097453 GAGTTGAAAGGGAAGTTGGCTGG - Intergenic
1008589194 6:52976302-52976324 GAGTTTAGAGGGAAGTTTGAGGG + Intergenic
1010379342 6:75207429-75207451 CAGTCGAAAGGCAAGTTTGGAGG - Intergenic
1010920052 6:81669862-81669884 AAGTTGATAGGCAACTTTGATGG - Intronic
1011230202 6:85152513-85152535 AATTCCAAAGGAAAATTTGAAGG - Intergenic
1012320267 6:97835654-97835676 AAGTTGCAAGGGAGGTTTTAGGG + Intergenic
1014474725 6:121858274-121858296 AAGTCTAAAGGAAAGTTTGATGG - Intergenic
1014744935 6:125189966-125189988 AAGTGGAAAGGTGAGTTTTAGGG - Intronic
1016132016 6:140485697-140485719 AAGTGGAGAGGGAAGGTGGAAGG - Intergenic
1022063570 7:26826433-26826455 AAGCAGAAAGGGAAGTTTATTGG - Intronic
1022077119 7:26982865-26982887 AAGTCGAAAGGAAAGTTTGATGG - Intronic
1023517027 7:41011358-41011380 AAGACAAAAGGGAAGTGAGAAGG + Intergenic
1026578339 7:71593212-71593234 AAGTCTAAATGGAAATTTCATGG + Intronic
1028436885 7:90814288-90814310 CAGTCGGAAGGAAAGTTTCAGGG + Intronic
1030546992 7:110908239-110908261 AAGGAGAGAGAGAAGTTTGATGG - Intronic
1031239947 7:119224668-119224690 AAATAGAAATAGAAGTTTGAGGG + Intergenic
1031405683 7:121383868-121383890 AATTCAAAAGGAAATTTTGATGG + Intronic
1032771629 7:135064837-135064859 TAGTCAAAAGGGAAATTTGTTGG + Intronic
1035661119 8:1349502-1349524 AGGTAGAAAGGGGTGTTTGAGGG + Intergenic
1042448174 8:68913692-68913714 AAGTAGAAAGGGATGTTTTGTGG + Intergenic
1043153569 8:76748758-76748780 AAGTGGAAAGGCTAGTTTGGAGG - Intronic
1047002855 8:120590263-120590285 ATGGCAAAAGGGAATTTTGAGGG - Intronic
1047240130 8:123079775-123079797 AAGGAGAAAGGAAAGCTTGAAGG - Intronic
1047272029 8:123370258-123370280 AAGTAGAGAAAGAAGTTTGAAGG + Intronic
1047924856 8:129672740-129672762 AAATGGTAAGGGAACTTTGAAGG - Intergenic
1050028602 9:1361934-1361956 AAGTCAAAATGGAAGTTTTGAGG - Intergenic
1050619566 9:7438580-7438602 AAGGAGAAAGGGAAATTAGAAGG + Intergenic
1050764790 9:9118930-9118952 AATTACAAAGGGAAGTTAGAGGG + Intronic
1053157075 9:35788962-35788984 AAGACAAAAGGGAAGTGGGAAGG - Intergenic
1053219883 9:36303624-36303646 AAGTTGAAAGGAAAGTTTTATGG - Intronic
1053761891 9:41353754-41353776 GAGGCGAAGGGGAGGTTTGAGGG - Intergenic
1062201444 9:135304995-135305017 AAGTGGAAAGGCCTGTTTGAGGG + Intergenic
1186433660 X:9525262-9525284 AAGTCTAATGGGAATTTGGAAGG - Intronic
1186662994 X:11687886-11687908 AAGCAGAAAGGGAATTTTGAGGG - Intergenic
1188395137 X:29673528-29673550 TAGTAGAAAGGGAAGTTTTACGG - Intronic
1188411696 X:29880684-29880706 CTGTCAAAAGGGAAGTTTGATGG - Intronic
1188529970 X:31129064-31129086 AAGACAAAAGGGAAGTGTGCTGG + Intronic
1188742131 X:33797931-33797953 AAGCTTCAAGGGAAGTTTGAAGG + Intergenic
1189344564 X:40231161-40231183 AAGTCCAAATGAAAGTTTTAGGG - Intergenic
1190748139 X:53338816-53338838 AAGAGGAAAGGGAAGTGGGAGGG - Intergenic
1190798815 X:53770024-53770046 AAGAGGAAAGGGAAGTGGGAGGG - Intergenic
1191920771 X:66254844-66254866 AAGTAGAAAAGAAAGGTTGAGGG + Intronic
1192272892 X:69600099-69600121 AAGTGGAAAGGCCAGTTAGAAGG + Intergenic
1193929535 X:87534944-87534966 AAGTGGAGAAGAAAGTTTGATGG + Intronic
1194658806 X:96605353-96605375 AAGTGGGAAGGGAAGTTTTCAGG + Intergenic
1194803251 X:98297141-98297163 AAGTTATAAGGGAGGTTTGAGGG + Intergenic
1195670763 X:107467937-107467959 AAGTCAAAAGGAAAGATAGAAGG - Intergenic
1195683809 X:107568116-107568138 AAAGAGAAAGGGAAGATTGAGGG + Intronic
1198260641 X:134961807-134961829 AAGTCGAAAGGAAAGTTTGATGG - Intergenic
1199309403 X:146305679-146305701 AAGTATAAAGGGTATTTTGAAGG + Intergenic
1199773179 X:150987792-150987814 AAGTCGAAAGGAAAGTTTGATGG + Exonic