ID: 1002508645

View in Genome Browser
Species Human (GRCh38)
Location 5:179698589-179698611
Sequence GCCCTCACCCGTCTGGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002508645_1002508651 -10 Left 1002508645 5:179698589-179698611 CCAGGAACCAGACGGGTGAGGGC 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1002508651 5:179698602-179698624 GGGTGAGGGCTACTGGGGGTTGG 0: 1
1: 0
2: 6
3: 33
4: 425
1002508645_1002508652 -9 Left 1002508645 5:179698589-179698611 CCAGGAACCAGACGGGTGAGGGC 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1002508652 5:179698603-179698625 GGTGAGGGCTACTGGGGGTTGGG 0: 1
1: 0
2: 1
3: 32
4: 305
1002508645_1002508654 8 Left 1002508645 5:179698589-179698611 CCAGGAACCAGACGGGTGAGGGC 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1002508654 5:179698620-179698642 GTTGGGTTGGAACGCCCCGAAGG 0: 1
1: 0
2: 0
3: 0
4: 24
1002508645_1002508659 29 Left 1002508645 5:179698589-179698611 CCAGGAACCAGACGGGTGAGGGC 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1002508659 5:179698641-179698663 GGCACCACAGCAACCGACGCGGG 0: 1
1: 0
2: 1
3: 0
4: 68
1002508645_1002508658 28 Left 1002508645 5:179698589-179698611 CCAGGAACCAGACGGGTGAGGGC 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1002508658 5:179698640-179698662 AGGCACCACAGCAACCGACGCGG 0: 1
1: 0
2: 0
3: 4
4: 46
1002508645_1002508653 -5 Left 1002508645 5:179698589-179698611 CCAGGAACCAGACGGGTGAGGGC 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1002508653 5:179698607-179698629 AGGGCTACTGGGGGTTGGGTTGG 0: 1
1: 0
2: 4
3: 49
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002508645 Original CRISPR GCCCTCACCCGTCTGGTTCC TGG (reversed) Intronic
900568608 1:3347471-3347493 GCCCTCCTGCGTCTGGTCCCAGG + Intronic
900859499 1:5218033-5218055 GCCTTCACAGGTCTGGTCCCTGG + Intergenic
901868846 1:12125776-12125798 GCCCTCCCTCGCCTGGCTCCAGG - Intronic
904818885 1:33227510-33227532 TCACTCACACGTCTGGCTCCTGG - Intergenic
915471943 1:156130841-156130863 GCCCTCCCCCATGTGGTGCCTGG + Intronic
915509506 1:156378778-156378800 GCCTTTGCCTGTCTGGTTCCCGG + Intronic
919787461 1:201268870-201268892 GCACTCCCACGTCTGGGTCCAGG + Intergenic
922891279 1:229063544-229063566 GCCCTCACTTGTCTGGATCTAGG - Intergenic
1065939794 10:30553982-30554004 GCCCTCACCAAGCTGGATCCTGG - Intergenic
1066231156 10:33435022-33435044 GCCCTCGCCAGTCAGGTTTCTGG + Intergenic
1070664893 10:78336067-78336089 GCCCCCACCCATCTGGGTGCAGG + Intergenic
1070986739 10:80696092-80696114 GTCCTCACCAGTCTGGTTGGAGG + Intergenic
1073036551 10:100567751-100567773 GTCCTCACTCATCTGGCTCCAGG + Intergenic
1074157340 10:110810448-110810470 GGCCTCACCTGTCTGCTTCCCGG - Exonic
1076830264 10:132990984-132991006 ACCCACACCCGTGTGTTTCCCGG + Intergenic
1077472402 11:2770205-2770227 GCCCCCACCCATCTGGGCCCTGG + Intronic
1080979602 11:37385460-37385482 GCCCTCACCCCTCTGCTTAGGGG - Intergenic
1082655951 11:55857273-55857295 GCCCCCACCCGCATGGCTCCTGG + Intergenic
1083447168 11:62715856-62715878 GCACTCACCCCTCTGTTTCCAGG + Exonic
1085465747 11:76722188-76722210 CCCCTCACCCCTCTGCCTCCTGG + Intergenic
1085646297 11:78225265-78225287 ACCCTCACCAGTGTGGTTCAAGG + Intronic
1090240620 11:125179016-125179038 GCCCTCTCCCGTGTGTTTCATGG + Intronic
1091305771 11:134535256-134535278 GCCTTCACCCCTCTGCTGCCTGG - Intergenic
1094142183 12:27192535-27192557 GTCCTTACTCTTCTGGTTCCTGG + Intergenic
1095410040 12:41911589-41911611 CCCCTCACCCAGCTGGTTTCAGG - Intergenic
1100285371 12:93160873-93160895 TCCCTTTCCTGTCTGGTTCCAGG + Intergenic
1102030990 12:109740011-109740033 GCCCTCGCCTGTCTGGCTGCAGG - Intronic
1102566031 12:113798117-113798139 CCCCTCACCCGCCTCCTTCCTGG + Intergenic
1102674679 12:114649620-114649642 GCCCTCACCCCTCAGGAGCCCGG + Intergenic
1103541969 12:121672504-121672526 ACCCCAAGCCGTCTGGTTCCCGG - Intronic
1105027150 12:132856909-132856931 GCCCTCACTTGTCTGGGTGCTGG + Intronic
1114173797 14:20300667-20300689 CACCTCACCCAGCTGGTTCCAGG + Exonic
1117010130 14:51462547-51462569 GACCCCACCTTTCTGGTTCCTGG + Intergenic
1122595493 14:102887437-102887459 GCCCTCACCCATCAGCTTCAAGG - Intronic
1132726573 16:1341495-1341517 GCCCTCGCCCGTCTGGGTGCGGG + Intronic
1132883114 16:2171003-2171025 GCCCTCGCCCGCCTCCTTCCTGG - Intronic
1133287470 16:4697302-4697324 GCGCTCAGTCGTCTGGTCCCCGG + Intronic
1138433525 16:56984196-56984218 GCCCTCAGAGGTCTGGTTTCTGG + Intergenic
1139540393 16:67610954-67610976 ACCCCCATCCGTCTGGTTCTGGG - Exonic
1139948592 16:70658240-70658262 CTCCCCACCAGTCTGGTTCCAGG - Intronic
1141592849 16:85080090-85080112 GCCCTCTGCCCTCTGGGTCCCGG - Intronic
1142187904 16:88703166-88703188 GCACCCACCCGTCTGCTTTCTGG - Intronic
1142654270 17:1380629-1380651 ACCCCCACCCGTCTGGATTCCGG - Intronic
1144650696 17:17005103-17005125 GCCCTCAGCCCTCAGGTCCCAGG + Intergenic
1144781403 17:17810199-17810221 GCCCTGTGCCGTCCGGTTCCGGG - Exonic
1145310705 17:21699793-21699815 ACCCTCACCAGTCTGGTAGCTGG + Intronic
1150770087 17:68033527-68033549 GCCATAAGCAGTCTGGTTCCAGG - Intergenic
1151260934 17:72915432-72915454 CCCCTCACTCTTCTGCTTCCTGG + Intronic
1151328891 17:73395171-73395193 GCCCACCACCGTCTGGCTCCAGG + Exonic
1151624882 17:75270601-75270623 GCCCTCACCCGGCATCTTCCTGG - Intronic
1156203870 18:34864574-34864596 GCCCTCAGCAGTCTGGTTTCAGG - Intronic
1161285244 19:3464966-3464988 GCCCTGACCCCTCTGGAGCCCGG - Intronic
1161768091 19:6217691-6217713 CCCCTCACCAGCCTGGCTCCAGG + Intronic
1162111564 19:8402570-8402592 ACCCACACCCATCTGGTCCCCGG - Intronic
1163039953 19:14594668-14594690 GCTCTCACCTGTCATGTTCCGGG - Exonic
1163715543 19:18870353-18870375 GCCCTCAGCCCACTGGTCCCGGG - Exonic
1164207544 19:23070935-23070957 CCTCCCACCCCTCTGGTTCCTGG - Intergenic
1166241428 19:41497222-41497244 GCCCACACTCCTCTGGTTCTGGG + Intergenic
1167291269 19:48626317-48626339 GCCCTCACCTGTCTGCTCCGAGG + Exonic
925098720 2:1228325-1228347 GCCCTGATCCATCTGGTTTCTGG + Intronic
925734408 2:6948736-6948758 GCCCACACCCATCTGGATCCTGG - Intronic
932881153 2:75503343-75503365 GCCCTCCCCACTCTGCTTCCTGG - Intronic
938065666 2:128280797-128280819 GTCCTCACCCATGTGCTTCCTGG + Intronic
945126575 2:206517775-206517797 GTCCTAACCATTCTGGTTCCTGG + Intronic
946402810 2:219477392-219477414 GACCTCACCCGCCAGGTTCTGGG - Exonic
1169487075 20:6042585-6042607 GTTCTCACCTGTCTGCTTCCTGG + Intronic
1170120296 20:12904153-12904175 GCCCTTAGCTCTCTGGTTCCCGG + Intergenic
1170614196 20:17936049-17936071 TCACTCACCTGTCTGCTTCCTGG + Intergenic
1170998589 20:21391438-21391460 GGCCTCACCCGGCCCGTTCCTGG - Intergenic
1171532301 20:25860732-25860754 GCCCCCACCCGCCGGGTCCCAGG - Intronic
1171532623 20:25862401-25862423 GCCCCCACCCGCCGGGTCCCAGG - Intronic
1172318771 20:33979358-33979380 GTGCTCACCTGTCTGGTGCCTGG - Intergenic
1172765450 20:37348330-37348352 GCCATCTCCTCTCTGGTTCCTGG - Intronic
1179190933 21:39121263-39121285 GCCCTCACCAGACTGCATCCTGG + Intergenic
1180198986 21:46213597-46213619 GCCCTGACACTGCTGGTTCCTGG + Intronic
1183060011 22:35330621-35330643 GCCCTCAGCTGTCTTCTTCCAGG + Intronic
1184320657 22:43739956-43739978 GGCCACACCCGACTGGCTCCTGG + Intronic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
950271596 3:11620400-11620422 GCCCTCACCCTGCTGGCTCAGGG - Intronic
952890488 3:38037090-38037112 CCCCTCCCCCCTCTGGCTCCAGG - Intergenic
954121825 3:48504194-48504216 GCCCCGGCCCGGCTGGTTCCCGG + Exonic
969668119 4:8573905-8573927 GCCATCAACCTCCTGGTTCCTGG + Intronic
971487069 4:27171321-27171343 GCCCTCACCCCTCTGGAACCTGG - Intergenic
974929947 4:68350203-68350225 GCCCTCAGCCCACTGGTACCTGG + Intergenic
987396643 5:17430687-17430709 ACCCCCAACCCTCTGGTTCCTGG - Intergenic
992700212 5:79334337-79334359 GCCCTCTCCTGCCTGGTTCTGGG + Intergenic
993636083 5:90345416-90345438 GCCCTCACTTGTCTTGTTCAAGG + Intergenic
993955039 5:94221945-94221967 GCCTTTGCCCGTCTAGTTCCAGG + Intronic
997234729 5:132266214-132266236 TCCCTCTCTAGTCTGGTTCCTGG - Intronic
1000209113 5:159095222-159095244 CCCCTCGCCCCTCTGCTTCCCGG + Intronic
1001476716 5:172055672-172055694 GCCCTCACTCCTCTGGATCTTGG + Exonic
1002508645 5:179698589-179698611 GCCCTCACCCGTCTGGTTCCTGG - Intronic
1002775563 6:325042-325064 GCCCTCTCCCTGCTGGTGCCTGG + Intronic
1004823387 6:19394169-19394191 GCCCTGACAGGTATGGTTCCAGG - Intergenic
1006977449 6:38116444-38116466 GCTCTCACCTGTCTGATTCCTGG + Intronic
1014997784 6:128172977-128172999 TCCCTCACCCTAGTGGTTCCTGG - Intronic
1015170989 6:130252993-130253015 GCCTTCACCTGTCTGATTACTGG - Intronic
1018043554 6:159946174-159946196 GCCCTCACACGTCGGGGTCGTGG - Intergenic
1019360859 7:603638-603660 GCCCTCTCCACTCTGGGTCCTGG - Intronic
1019360912 7:603802-603824 GCCCTCTCCACTCTGGGTCCTGG - Intronic
1019361715 7:608435-608457 GCCCTGACCCTCCTGATTCCAGG + Intronic
1019923904 7:4179990-4180012 GCCCTGAGCCCCCTGGTTCCTGG - Intronic
1027726274 7:81809984-81810006 GCCCTCAACCGCCAGTTTCCAGG - Intergenic
1027846331 7:83381244-83381266 GACCTCACCTCTCTGGTTCATGG + Intronic
1033367827 7:140684810-140684832 GCTCCCACCCCTCTGGCTCCTGG + Intronic
1034308174 7:150063478-150063500 GCTCTCTCCTCTCTGGTTCCTGG + Intergenic
1034798681 7:154037193-154037215 GCTCTCTCCTCTCTGGTTCCTGG - Intronic
1036192959 8:6687878-6687900 CCCCTCACATGTCTGGTGCCTGG + Intergenic
1047402865 8:124560811-124560833 GCCCTCACCCATCTGTGCCCAGG - Intronic
1049469780 8:142770151-142770173 GCCGTCACCTGCCTGGTGCCAGG - Intronic
1049637087 8:143694860-143694882 GCCCACAGCCGTCTGGCTCAGGG + Exonic
1057073205 9:92118329-92118351 TCCCTCACACGTCTGGTACCTGG - Intergenic
1058990887 9:110255160-110255182 GCCCTGACCTGTTTGGTGCCGGG - Intronic
1061209133 9:129180830-129180852 GCCCAAACCCATCTGTTTCCAGG + Intergenic
1061897730 9:133657208-133657230 GTCCTCAGCCGTCCGCTTCCAGG + Exonic
1062089384 9:134667101-134667123 GCTCTCAGTCGTATGGTTCCTGG - Intronic
1062318499 9:135979411-135979433 GCCCTCACCCGACTGCCCCCGGG + Intergenic
1062444987 9:136589889-136589911 GCCCTCACCCACTTGGTTCTCGG + Intergenic
1188518755 X:31014715-31014737 GCCCTTGCCCGACAGGTTCCTGG - Intergenic
1189333256 X:40155551-40155573 GCCCGCTCCCGTCTGGGTCCGGG - Intronic
1193772670 X:85605912-85605934 ACCCTGACCACTCTGGTTCCAGG - Intergenic