ID: 1002514468

View in Genome Browser
Species Human (GRCh38)
Location 5:179746962-179746984
Sequence CTGTTTCAGGGGTAGGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002514468_1002514476 -9 Left 1002514468 5:179746962-179746984 CCAGCCGCCTACCCCTGAAACAG 0: 1
1: 0
2: 0
3: 13
4: 119
Right 1002514476 5:179746976-179746998 CTGAAACAGAGTCTCAGGCTGGG 0: 1
1: 0
2: 4
3: 26
4: 323
1002514468_1002514477 8 Left 1002514468 5:179746962-179746984 CCAGCCGCCTACCCCTGAAACAG 0: 1
1: 0
2: 0
3: 13
4: 119
Right 1002514477 5:179746993-179747015 GCTGGGTTTATTTTTATTTTTGG No data
1002514468_1002514475 -10 Left 1002514468 5:179746962-179746984 CCAGCCGCCTACCCCTGAAACAG 0: 1
1: 0
2: 0
3: 13
4: 119
Right 1002514475 5:179746975-179746997 CCTGAAACAGAGTCTCAGGCTGG 0: 1
1: 0
2: 1
3: 50
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002514468 Original CRISPR CTGTTTCAGGGGTAGGCGGC TGG (reversed) Intronic
901006169 1:6172645-6172667 CTGTTTCAGTGGGAGGGTGCTGG - Intronic
901196237 1:7441527-7441549 CTGGTGCAGGGGTGGGCTGCGGG + Intronic
901287115 1:8089553-8089575 CTGTTACAGTGGTAGGCGTCTGG + Intergenic
902092678 1:13915996-13916018 CTGTGGCAGGGGTTGGGGGCCGG + Intergenic
903268389 1:22172496-22172518 CTGTTGCATGGGGAGGCGTCAGG + Intergenic
903781775 1:25824660-25824682 GTGTCGCAGGGGTAGGGGGCAGG + Intronic
904660152 1:32077976-32077998 CTGCTTCTGGGGCAGGCTGCTGG + Intronic
913187551 1:116382948-116382970 CTGCTTCAGGGGGAGGTGTCTGG + Intronic
916821456 1:168402838-168402860 CTGTTTCACTGGTAGGCTGTGGG + Intergenic
1068528336 10:58156614-58156636 CTGTTTTGGGGGTAGGAGGCTGG + Intergenic
1070871488 10:79757796-79757818 TTGTTTCAGGGGAAGGAGGGAGG + Intergenic
1072808172 10:98438881-98438903 CTGTTTCAGGGGTTGGGCCCAGG + Intronic
1073110706 10:101061634-101061656 CTGCATAAGGGGGAGGCGGCAGG - Intergenic
1073420686 10:103421499-103421521 CTGATTCAGGAGGAGGAGGCTGG - Exonic
1074516929 10:114179197-114179219 CTGCTTCCGGGGAAGGCGGAGGG + Intergenic
1075784067 10:125036542-125036564 CTGTGTCAGGTGTAGGCAGTGGG + Intronic
1076472519 10:130728911-130728933 CTGGTTCCAGGGTAGGGGGCAGG - Intergenic
1076868666 10:133182082-133182104 CTGTCTCAGGGTCAGGCTGCAGG - Intronic
1078155325 11:8794995-8795017 CTGTTTCAGGGACAGCCAGCAGG - Intronic
1080789616 11:35510463-35510485 CTGTTTCCGGGGGTGGGGGCGGG - Intronic
1084963481 11:72730689-72730711 CTGTTTTTGGGGGAGGCGGGAGG - Intronic
1086669926 11:89533868-89533890 CTGTTTCAGGGGAAGGATGTGGG - Intergenic
1089667980 11:120032411-120032433 CTGCTGAAGGGGTAGGTGGCAGG - Intergenic
1092966370 12:13647618-13647640 CTCTTTCAGGGGTAAGAGGTGGG - Intronic
1094447753 12:30550180-30550202 CTGTCTCAGTGGCAGGAGGCAGG - Intergenic
1098898876 12:76092411-76092433 CTGATTCTGAGGTAGGAGGCAGG + Intergenic
1102270392 12:111529678-111529700 CTGTTTCCTGGGTATGGGGCTGG - Intronic
1102470554 12:113157668-113157690 CTGTGTCAGGGCTAGGAGGCAGG - Exonic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1119614753 14:76091695-76091717 CTGTTACAGGGATAGGGAGCAGG + Intergenic
1120429926 14:84400944-84400966 ATGTGTCAGGGGTAGGGAGCAGG + Intergenic
1122980728 14:105191386-105191408 GGGTCTCAGGGGGAGGCGGCTGG - Intergenic
1123419203 15:20117739-20117761 CTGTTGCAGGGGTGGGGGACTGG + Intergenic
1123446660 15:20335760-20335782 CTGTTGCAGGGGTGGGGGACTGG - Intergenic
1123528425 15:21124282-21124304 CTGTTGCAGGGGTGGGGGACTGG + Intergenic
1128496073 15:68199439-68199461 CAGTTTGAGGGGCAGGTGGCAGG - Intronic
1131450179 15:92532860-92532882 CTGGTTTAGGGGTAGGCAACAGG - Intergenic
1132060456 15:98688165-98688187 TTGTTTCACGGGTAGGGGGCAGG + Intronic
1139540385 16:67610942-67610964 CTGGTTCTGGGGTAAGTGGCAGG - Exonic
1142285447 16:89169772-89169794 TTGTGTCAGAGGTAGGTGGCAGG - Intergenic
1142347234 16:89561563-89561585 CTGGTTCTGGGGCAGGTGGCCGG + Exonic
1203137893 16_KI270728v1_random:1740973-1740995 CTGTTGCAGGGGTGGGGGACTGG - Intergenic
1144794040 17:17878954-17878976 TGGTTTCAGGGGTAGACTGCAGG + Intronic
1149154773 17:53614633-53614655 CTGTTTTAGTGGGAGGCAGCAGG - Intergenic
1151950352 17:77350109-77350131 CTGTTTCAGGGCCAGGGGCCTGG + Intronic
1154510541 18:15096429-15096451 ATGGTTCTGGGGTAGGTGGCTGG + Intergenic
1155838230 18:30613764-30613786 CTGTGTCAGGGGCATGAGGCTGG - Intergenic
1159693823 18:71527891-71527913 CTGTTTCAGGAGTAGTGGTCAGG + Intergenic
1165164500 19:33842047-33842069 CTGTTTCAGGGGTAGCTGGAGGG - Intergenic
1166338147 19:42121590-42121612 CTGGTCCAGGGGTAGCAGGCAGG - Intronic
1167438743 19:49496026-49496048 CTTTTTGAAGGGTGGGCGGCCGG - Intergenic
926089087 2:10038369-10038391 CTTTTCCAGGGGCAGGCAGCTGG + Intergenic
928429200 2:31204020-31204042 CTGTTTTGGGGGTAGGAGGTTGG + Intronic
930320480 2:49848408-49848430 CTGTTGGAGGGGTAGGGGGAGGG - Intergenic
932176064 2:69603833-69603855 GTGTTTCAGGAGTTGGCAGCAGG + Intronic
933990340 2:87629112-87629134 CTTTTTCAGGGATAGGCTGGTGG - Intergenic
934031821 2:88055451-88055473 CTCTTTCCGGGGGCGGCGGCCGG + Intronic
936303506 2:111321712-111321734 CTTTTTCAGGGATAGGCTGGTGG + Intergenic
936381902 2:111993841-111993863 CTGGTTCAAGGGCAGGTGGCAGG + Intronic
936949717 2:117965756-117965778 CAGTGTCAGGTGTAGGGGGCAGG - Intronic
937721539 2:125102354-125102376 CTGTTGCGGGGGTGGGAGGCTGG + Intergenic
938505758 2:131880876-131880898 ATGGTTCTGGGGTAGGTGGCTGG + Intergenic
942171897 2:173297643-173297665 CTGGTGCAGGAGTAGGGGGCCGG + Intergenic
948398152 2:237662729-237662751 CTGCTTCTGAGGTAGGAGGCGGG + Intronic
1171860747 20:30400564-30400586 GTGTTTAAGGGTTAGGCAGCTGG - Intergenic
1172328653 20:34058076-34058098 CTTTTTGAGGGGAAGGGGGCCGG + Intronic
1172930914 20:38585967-38585989 CTGGGTCAGGGGTAGGAGACAGG + Intronic
1173111278 20:40192777-40192799 CTCTTTCATGGGTAGGAGGTGGG - Intergenic
1175964228 20:62652405-62652427 CTGTTTCGGCGGCCGGCGGCCGG + Intronic
1176787325 21:13272981-13273003 ATGGTTCTGGGGTAGGTGGCTGG - Intergenic
1177196913 21:17912748-17912770 CTGGATCAGGGGTGGGAGGCAGG + Intronic
1177524462 21:22273862-22273884 CCCTGTCAGGGGTAGGTGGCTGG + Intergenic
1177676487 21:24307856-24307878 CTGCTTCTGGGGAAGGCTGCAGG + Intergenic
1177986488 21:27981475-27981497 ATGGTTCTGGGGTAGGCGGCTGG - Intergenic
1178434957 21:32550000-32550022 CTGTGTCAGGGGTGGGCTGCAGG - Intergenic
1178710440 21:34911931-34911953 ATGGTTCAGGGGTAGGGAGCGGG - Intronic
1180552713 22:16553530-16553552 CTGTTGCAGGGGTGGGGGACTGG - Intergenic
1183756909 22:39775901-39775923 CTTTTTAAGGGGTTGGGGGCAGG + Intronic
1183808653 22:40235406-40235428 CTGTTACAGGGGTAGGCTCCAGG + Intronic
1184021961 22:41826928-41826950 CTCTGTCAGTGGTAGGGGGCTGG - Intergenic
1184132966 22:42528788-42528810 CTGTTTCTGGGGCATGCTGCAGG + Intergenic
1184987000 22:48142517-48142539 CTGTTTCAGGGGCTGGTGACGGG + Intergenic
1185116243 22:48939849-48939871 CAGACTCAGGGGGAGGCGGCCGG + Intergenic
1185322331 22:50207533-50207555 CAGCCTCAGGGGTGGGCGGCTGG - Intronic
1185403205 22:50629073-50629095 CTGTTGCAGGGTTACGCTGCTGG + Intergenic
961337062 3:126186928-126186950 CAGTTTCAGGTGGTGGCGGCTGG - Intronic
968058185 3:195708975-195708997 TTGTTTTAGGGGTAGGAGCCAGG + Intergenic
969482996 4:7456765-7456787 CTGTGGCAGGGGTAGGGGGGTGG + Intronic
969957495 4:10906237-10906259 CTTTTTCAGGGGTAGAAGGATGG - Intergenic
974831971 4:67200902-67200924 CTGTTTTAGGTTTAGGGGGCAGG - Intergenic
978536612 4:109769811-109769833 CTGTTTCAATGGTAGGCAGCAGG - Intronic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
986243042 5:5978712-5978734 CTGTATCACGGGTGGGAGGCTGG - Intergenic
993032428 5:82720753-82720775 CTTTTTCCGGGGTGGGGGGCGGG + Intergenic
998459305 5:142297620-142297642 CTGTGTCAGGGGTTGGCGAGGGG + Intergenic
1001084697 5:168692115-168692137 CTGTTGCAGGGGAAGGGGGCAGG - Intronic
1001317094 5:170651326-170651348 CTGTATCAGGGGAAGGCAGGTGG + Intronic
1002514468 5:179746962-179746984 CTGTTTCAGGGGTAGGCGGCTGG - Intronic
1002674536 5:180900207-180900229 CTGTTTCCGGGTGAGGCAGCAGG + Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1008292612 6:49736329-49736351 CTGTGGAAGGAGTAGGCGGCTGG - Intronic
1010814260 6:80338384-80338406 CTGGTTCCGGGGTCGGGGGCTGG - Intronic
1014622604 6:123687745-123687767 CTGGTTCAGGGCTAGGGGGTTGG + Intergenic
1017616765 6:156254295-156254317 CTGTGTCAGGGGCAGGCTGCAGG - Intergenic
1018416712 6:163607977-163607999 CTGGTTCAGGGATGGGCGGGCGG + Intergenic
1018468789 6:164078707-164078729 CTGTCTCAGGGGAAGGCTGCTGG + Intergenic
1024372374 7:48601375-48601397 CTGTTGCGGGGGTGGGAGGCTGG - Intronic
1025008739 7:55377838-55377860 CTGTTTCTGGGCTATGTGGCAGG + Intronic
1028303613 7:89233587-89233609 CAGTTTGAGGGGTAGGCTGGAGG + Intronic
1029371637 7:100154565-100154587 CTGTCTCAGGGGTTGGGGACAGG - Exonic
1029737612 7:102473363-102473385 CTGTTTCAGGGGCGTCCGGCTGG - Exonic
1033567872 7:142597405-142597427 CTGTTTTATGGGCAGGGGGCAGG - Intergenic
1035155068 7:156905810-156905832 CAGTTTTAGGGGTTGGGGGCAGG + Intergenic
1035616528 8:1006218-1006240 CTTTTTCAGGGGTTGGGGGATGG - Intergenic
1036050704 8:5192994-5193016 CTGTTTGTGGGGTAGGGGGACGG + Intergenic
1038713592 8:29971995-29972017 CTGCTTCAGGCTTAGGCAGCTGG - Intergenic
1045425765 8:102064376-102064398 CTGTTTCAGGGACATGGGGCTGG - Intronic
1048064143 8:130950477-130950499 CTGTGTCAGGGTTTGGGGGCTGG + Intronic
1049426756 8:142541192-142541214 CTCTGTCAGGGGCAGGCGGCTGG + Intronic
1057410189 9:94811018-94811040 ATGTGACAGGGGTAGGGGGCAGG - Intronic
1059965130 9:119606254-119606276 ATGTGTCAGGGGTGGGGGGCTGG - Intergenic
1060894117 9:127206725-127206747 CTGTTTCTGGGCTAGGAGGTTGG - Intronic
1061385305 9:130286122-130286144 CTGCTTCAGGGGTGAGCAGCAGG - Intronic
1061527307 9:131176870-131176892 CTGTTTCAGGGGTGGAGGACAGG - Intronic
1062049319 9:134438884-134438906 TGCTTTCAGGGGTTGGCGGCCGG - Intronic
1062079745 9:134617560-134617582 CTGTTTCTGGGGTGGGCGATAGG - Intergenic
1062194977 9:135267951-135267973 TTATTTCAGGGGGAGGGGGCGGG - Intergenic
1062529861 9:136995095-136995117 CTGGTACAGGGCTAGGGGGCAGG + Exonic
1185532896 X:835845-835867 CTGTTGCAGGGGTGGGGGACTGG - Intergenic
1196751938 X:119126136-119126158 CTGTTTCATGGGTGGGCTTCAGG + Intronic
1198745055 X:139881455-139881477 ATGTGGCAGTGGTAGGCGGCCGG + Intronic
1199951107 X:152706771-152706793 CAGTGTCTGGGGTAGGGGGCTGG + Intergenic
1199958577 X:152761690-152761712 CAGTGTCTGGGGTAGGGGGCTGG - Intergenic