ID: 1002515252

View in Genome Browser
Species Human (GRCh38)
Location 5:179753225-179753247
Sequence GCGCGCGCGCGCGCGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 8, 2: 12, 3: 73, 4: 280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002515252 Original CRISPR GCGCGCGCGCGCGCGTGCTG GGG Intronic
900162827 1:1232420-1232442 GCGCGCGCGGGCGCGGGGGGAGG - Exonic
901660147 1:10794197-10794219 GTGCGCGCGCGCGCGCGTCGTGG + Intronic
902044331 1:13513721-13513743 GCGTGCGCCCGGGCGTGCGGGGG + Exonic
902348428 1:15835918-15835940 GCGCGCGCGCGCTCGCCGTGCGG + Intergenic
902470386 1:16644717-16644739 GCGCGAGCGTGCGCGTGATTTGG - Intergenic
902916795 1:19644423-19644445 GCGCGCGCCCGCCGGTCCTGCGG - Intronic
903879824 1:26500969-26500991 CCACGCGCGCGCACGTGCCGGGG + Intergenic
904181349 1:28668858-28668880 GGGCGCGCGGGCGCGGGGTGGGG + Intronic
904563389 1:31413316-31413338 GCGCGCGCGGGCGGGCGCCGGGG - Intronic
904847475 1:33430948-33430970 GGGCGGGCGCGTGCGCGCTGGGG - Intronic
905037687 1:34928710-34928732 GCGTGTGCGCGCGCGTGCGTTGG - Intronic
905231835 1:36519251-36519273 GCGCGCGCGCTCACGTGCAGGGG + Intergenic
907526478 1:55056865-55056887 GCGTGCGCGCGCGCGCGTTGGGG + Intronic
908703855 1:66930135-66930157 CCGCGCGCGCGCCCCTGCTCCGG + Intronic
910533951 1:88275030-88275052 GCGCGCGCGCGCGCGCGCCTGGG + Intergenic
911163718 1:94707495-94707517 GCGGGCGTGGGCGAGTGCTGTGG + Intergenic
911445485 1:97986811-97986833 GCGCACACGCGCGCGTCATGTGG - Intergenic
912684243 1:111749444-111749466 GTGCGCGCGCGCGCGTGCTAGGG + Intronic
914869118 1:151458807-151458829 GAGTGCGCGCGCGCGCGCCGCGG + Intronic
914923022 1:151860237-151860259 GCGCGCACACACACGTGCTGAGG + Intergenic
915142495 1:153776127-153776149 GCGCGCGCGCGCCGCAGCTGCGG - Exonic
917565382 1:176207269-176207291 GTGCGCGCGCGCGCGAGCGGCGG + Exonic
918048346 1:180954407-180954429 ACGCGTGCGCGCGTGTGCTGGGG - Intergenic
920600599 1:207320870-207320892 GCGCGCGCGCGCGCGCCTCGGGG - Intergenic
920600601 1:207320872-207320894 GCGCGCGCGCGCGCGCGCCTCGG - Intergenic
922648720 1:227318511-227318533 GTGTGCGCGCGCGTGTGCCGGGG - Intergenic
922958556 1:229625813-229625835 GCGCGCGCGCGGGCGGGCGGGGG - Intronic
923191709 1:231626668-231626690 GCGCGCGCGCGCGCGCGTCAGGG + Intronic
1064167770 10:13001505-13001527 GCAGGCGCGCGCGGGCGCTGGGG + Exonic
1065214701 10:23438881-23438903 CCGCGCGCGCTCGCGCGCCGAGG + Intergenic
1065520575 10:26567297-26567319 GCGGGCGCGGGCGCGGGCGGCGG - Exonic
1069976286 10:72215993-72216015 GCGTGCGCGCGCCCGTGCCGTGG - Exonic
1071086828 10:81875248-81875270 GCGGGCGCGGGCGCGGGCTCCGG - Intergenic
1071997567 10:91163008-91163030 GCGAGCGCGCGCGCGTGGGGCGG - Intronic
1072994194 10:100228970-100228992 GCGCGCGCGCGCGCGCTTGGAGG - Intronic
1074810204 10:117096994-117097016 GTGCGCGCGCGTGCGCGCTTGGG - Intronic
1076707287 10:132308638-132308660 GAGCGCGGGCGCACGTGCTCAGG - Intronic
1076895349 10:133308785-133308807 ACGCGGGCGCGGGCGTGATGAGG - Exonic
1077038638 11:507489-507511 GCGGGCGCGTGTGCGTGTTGTGG + Intergenic
1081528275 11:43942074-43942096 GTGCGCGCGCGCGCCTGCGGAGG + Intronic
1082035554 11:47642567-47642589 GCGTGCGTGCGCGCGCGCCGCGG - Exonic
1082775670 11:57242597-57242619 GCGCGCACGCGCGCGTGCCTAGG - Intergenic
1082928849 11:58579068-58579090 GCGCGCGCGCGCGCCGCCAGCGG + Intergenic
1083758283 11:64802820-64802842 GCGCCCGCGGGCGCGGGGTGCGG - Intronic
1084146153 11:67266429-67266451 GGGCGCGGGCGCGCGGGCGGCGG + Exonic
1084265727 11:68004199-68004221 GCGCGCGCGCGCGTGTGTGCAGG + Intronic
1084265729 11:68004201-68004223 GCGCGCGCGCGTGTGTGCAGGGG + Intronic
1087782637 11:102317631-102317653 GCGCGCGCGCGCGCCTCCCCTGG + Intronic
1088566745 11:111180602-111180624 GTGCGCGCACGCGTGTGGTGGGG - Intergenic
1088820483 11:113452472-113452494 GCGCGCGCGCGCGCGCACATTGG + Intronic
1088820485 11:113452474-113452496 GCGCGCGCGCGCGCACATTGGGG + Intronic
1089102570 11:115975878-115975900 GCGCGCGCGCGCGCATGAACTGG + Intergenic
1089713671 11:120336325-120336347 GCGGGCGCGCGCGCGGGTTCCGG - Intergenic
1089977444 11:122744897-122744919 GTGCGCGCGCGCGCGCACTTGGG + Intronic
1091402450 12:189201-189223 AGGCGCGCGCCCGCGTGCTAGGG + Intergenic
1092655044 12:10674872-10674894 GTGCGCGCGCGCGCGCGCGCGGG - Intergenic
1093547840 12:20369209-20369231 GTGCGCGCGCGCGCGTGGGTCGG + Intergenic
1093547842 12:20369211-20369233 GCGCGCGCGCGCGTGGGTCGGGG + Intergenic
1096101296 12:48971832-48971854 GCGCGCGCGCGCGCGCTGGGAGG - Intergenic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096994616 12:55830810-55830832 GCGCGCGCGTGCGCGCGGTGGGG - Intronic
1096994618 12:55830812-55830834 GCGCGCGCGCGTGCGCGCGGTGG - Intronic
1098161069 12:67648737-67648759 GGGCGCGCGCGCGCGGGCCCGGG + Exonic
1098350782 12:69557618-69557640 GTGCGCGCGCGCGCGCGCGCAGG + Intronic
1099989784 12:89709397-89709419 GTGCGCGCGCGCGCGCGCGGAGG + Intergenic
1101354718 12:103966121-103966143 GCGCGCGCGCGCGCACGCAGGGG + Intronic
1102084395 12:110124283-110124305 GCGCGCGCGCGCACGAGCTGGGG - Intergenic
1102256453 12:111418302-111418324 GCGCGCAGCGGCGCGTGCTGCGG - Exonic
1103348348 12:120265742-120265764 GCGGGCGCGGGCGCGCGCGGCGG - Exonic
1103940983 12:124501035-124501057 GTGCGCGCGCGCTCGTGCCGTGG - Intronic
1104568285 12:129903899-129903921 GCTCGGGCGCGCGCGCGCTCCGG + Intergenic
1104841704 12:131828835-131828857 GCGAGCGCACGCGAGTCCTGGGG + Intronic
1104961570 12:132490588-132490610 GCGCGCGCGAGCGCCGGCTCGGG - Exonic
1105409668 13:20161184-20161206 GCGGACGCGGGCGAGTGCTGTGG - Intergenic
1107078231 13:36346362-36346384 CCTCGCGCGCGCGCTTGCCGTGG + Intronic
1107770933 13:43786985-43787007 GCGCGCGCGCCCACGGGGTGGGG + Intergenic
1108408083 13:50124567-50124589 GAGAGCGCGCGCGCGGGCTTCGG - Intronic
1108542073 13:51453637-51453659 GCGCGAGCGGGCGCGGGCGGGGG + Intronic
1112216244 13:97434075-97434097 GGGCGCGCGCTCGAGCGCTGGGG + Intergenic
1112507041 13:99981603-99981625 GCGCGCGCGGGTGCGCGCAGGGG + Intergenic
1113517384 13:110914367-110914389 GCGCGCGCGCGCGGATGGTGCGG - Intronic
1113517387 13:110914378-110914400 GCGCGCGCGCGCGCTCGCACAGG + Intronic
1113655607 13:112066661-112066683 GCGCGCGCGCGCGGCGGCGGCGG - Intergenic
1114612752 14:24053045-24053067 GTGTGCACGCGCGTGTGCTGGGG - Intronic
1117721910 14:58637226-58637248 GTGCGCGCGCGTGCGCGCTTTGG - Intronic
1118323159 14:64765042-64765064 GCGCGCGCGCGCGCGGGTGGTGG + Intronic
1118925494 14:70187641-70187663 CCGCGCGCGCGTGTGTGTTGGGG + Intronic
1119325275 14:73756296-73756318 GCGCGCGCGCGTGCGCGCTGAGG + Intronic
1122265916 14:100546761-100546783 GTGCGCGCGCGCGCGCGCGCCGG - Intronic
1122648029 14:103207758-103207780 GCGAGCGCCTGCGCGGGCTGTGG + Intergenic
1122993333 14:105249099-105249121 GCGCGCGGGCGCGGGGGCCGCGG - Intronic
1123653423 15:22494627-22494649 GCGGGAGCGCGTGCGTGCGGCGG + Intergenic
1124109529 15:26773152-26773174 GCGCGCGCGGGCGCGGGGCGGGG + Intronic
1125201017 15:37100746-37100768 GCGCGCGCGCGCGCGCGAACAGG + Intronic
1125270535 15:37934101-37934123 GCGCGCGCGCGTGTGTGTAGGGG - Intronic
1125270537 15:37934103-37934125 GCGCGCGCGCGCGTGTGTGTAGG - Intronic
1125521960 15:40353147-40353169 GCGCGCGCGCGCGCATCCGTGGG + Intronic
1126393924 15:48191624-48191646 GCGCGCGCGCACACGTACTTCGG + Exonic
1126766478 15:52016049-52016071 GCGCGCGCGCGCGCGCGCGATGG - Intronic
1126800838 15:52295475-52295497 GGGCGGGCGGGCGCGCGCTGGGG - Intronic
1127931643 15:63600986-63601008 GCGGGCGCGCGCGGGCGCGGGGG - Intronic
1127931647 15:63600991-63601013 GCGCCCGCGCGCGCCCGCCGCGG + Intronic
1128791138 15:70434707-70434729 GCGCGCGCGCGCGGGTGGAGCGG - Intergenic
1129503207 15:76059798-76059820 GGGCGCGCGCGCGCGGCCGGCGG + Intergenic
1130225318 15:82052938-82052960 GCGCGCGTGCGCGCGCAGTGAGG - Intergenic
1130656422 15:85794706-85794728 GAGCGGGGGCGCGGGTGCTGCGG + Intronic
1132055548 15:98648510-98648532 TCGCGCGCGCGCGCGCGCCCTGG - Intergenic
1132522305 16:397381-397403 GTGCGCGCACGTGCGGGCTGGGG + Intronic
1132683266 16:1152529-1152551 CCGCGCGCGCGTGTGTGATGGGG - Intergenic
1132683833 16:1154109-1154131 GCGCGCGGGGGCGCATGCCGAGG - Intronic
1133029622 16:3004274-3004296 GCGCGGGCGCGGGCGAGCCGCGG - Intergenic
1133340664 16:5033668-5033690 GCGCGCGCGCGCGCCTCCCCCGG - Exonic
1133340666 16:5033677-5033699 GCGCGCGCGCGCGCGTGGATAGG + Exonic
1135656685 16:24256282-24256304 GTGTGCGAGCGCGTGTGCTGGGG - Exonic
1136399871 16:30011441-30011463 GCGCGCGCGGGCGGGGGCGGGGG - Intronic
1136478531 16:30527257-30527279 GCGGGCGCGCGCAGGTGCCGGGG - Intronic
1136705992 16:32188324-32188346 GCGGGCGTGCGTGCGTGCCGCGG - Intergenic
1136761920 16:32741081-32741103 GCGGGCGTGCGTGCGTGCCGCGG + Intergenic
1136806180 16:33129307-33129329 GCGGGCGTGCGTGCGTGCCGCGG - Intergenic
1137261234 16:46831379-46831401 GCGAGCTCGCGGGCGGGCTGTGG - Exonic
1138178708 16:54928780-54928802 CCGCGCGGGCGCGCGGGCCGCGG + Intergenic
1138956860 16:61981682-61981704 GCGCGCGCGCGCGTGCGCTTGGG + Intronic
1140462244 16:75148959-75148981 CCGCGCGCGCGCGCCCGCCGGGG - Intronic
1140462249 16:75148966-75148988 GGGCGCGCGCGCGCGGGACGAGG + Intronic
1141647277 16:85374540-85374562 GTGTGCGCGCGCGCGTGCACAGG + Intergenic
1141989588 16:87602467-87602489 GCGCGCGGGCGGGCGGGGTGCGG + Intronic
1203064079 16_KI270728v1_random:1001397-1001419 GCGGGCGTGCGTGCGTGCCGCGG + Intergenic
1142509819 17:386210-386232 GCGAGGGAGCGCGCGGGCTGCGG - Intronic
1142762267 17:2049736-2049758 GCTCGAGCGCGCGCGTCCTGCGG - Intergenic
1142810220 17:2392683-2392705 GCGTGGGTGCGCGCGTGCTTCGG - Intronic
1144816597 17:18039597-18039619 GGGCGCGCACGCGCGGGGTGGGG - Exonic
1146445310 17:32928158-32928180 GCGCGGGCGCGGGCCTGCAGCGG - Exonic
1146601966 17:34225229-34225251 GCGCGCGTGCGCGCGTGTTGGGG - Intergenic
1147440332 17:40443661-40443683 GCGGGCGCGCGGGCGAGCGGCGG - Exonic
1147742747 17:42678130-42678152 ACGCGCGCGCGCGCCCGCGGAGG - Intergenic
1148271728 17:46266919-46266941 GCGCGCGCGCGGCCGGGCGGCGG - Intergenic
1148284060 17:46372681-46372703 GAGCCCGCGCGCGCGCCCTGTGG + Intergenic
1148306281 17:46590602-46590624 GAGCCCGCGCGCGCGCCCTGTGG + Intergenic
1149994772 17:61400600-61400622 GCGGGCGGGCGGGCGGGCTGGGG + Intronic
1150643394 17:66964408-66964430 GCGCGCGCGGGCGCGGGGAGGGG + Intergenic
1151490925 17:74432025-74432047 GTGCGCGCGCCCGCATGCGGGGG + Exonic
1152606699 17:81295067-81295089 GCCCGCGCCCGCGCCTGCTCAGG - Exonic
1152970622 18:158339-158361 GCGCAGGCGCGCACCTGCTGCGG + Intergenic
1153457515 18:5296220-5296242 GCGCGTGCGCGCGCGTGCGCAGG - Intronic
1153457519 18:5296231-5296253 GCGCGCACGCGCGCGGCTTGGGG + Intronic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1158427474 18:57352713-57352735 GTGAGCGCGCGCGCGTGTGGCGG - Exonic
1160204516 18:76822321-76822343 GCGCGGGCGCGGGCGCGGTGGGG - Intergenic
1160263900 18:77321983-77322005 GCACGCGCACACGTGTGCTGGGG + Intergenic
1160429132 18:78799603-78799625 GTGCGCGCGCGCGTGTGCAGTGG - Intergenic
1160452401 18:78974324-78974346 GCGTGCGCGTGCGCGTGCGAAGG - Intergenic
1160500714 18:79400127-79400149 GCGCGCGCGCGAGGGGGCGGGGG + Intronic
1160556513 18:79729095-79729117 CCGCGCCAGCGCTCGTGCTGGGG + Intronic
1160763695 19:797929-797951 GCGGCCGCGCACGCGCGCTGGGG - Intronic
1160967550 19:1753311-1753333 GCGCCCGCCCGCGCCCGCTGGGG - Exonic
1161643070 19:5436362-5436384 GCGCGCGCGCGCGTGCGGGGAGG + Intergenic
1161643072 19:5436364-5436386 GCGCGCGCGCGTGCGGGGAGGGG + Intergenic
1161802583 19:6424400-6424422 TCGCGCGCGCGCGCAGGCGGGGG - Intronic
1161802587 19:6424406-6424428 GCGCGCTCGCGCGCGCGCGCAGG - Intronic
1163547452 19:17948437-17948459 GCGCGGGGGAGCGGGTGCTGGGG + Intergenic
1163649607 19:18509572-18509594 GCGCGCGCGCGCACGTGCATTGG - Intronic
1163727214 19:18929535-18929557 GCGGGAGCGGGCGCGGGCTGAGG - Exonic
1164835148 19:31350974-31350996 GCGCCCGGGCGCGCCGGCTGGGG + Intergenic
1165157569 19:33797290-33797312 GCGCGCGCGCGCGCTTGTGGAGG + Intronic
1166304194 19:41928393-41928415 GCGCGGGCGGGCGCGCGCCGGGG + Intronic
1166347787 19:42177072-42177094 GCGGGCGCGCAGGCGAGCTGGGG + Intronic
1166780787 19:45341575-45341597 GTGTGCGCGCGCGCGTGTGGTGG + Intronic
1166802585 19:45467640-45467662 GCGCGCGCGCGAGCGAGCGAGGG + Intronic
1166975052 19:46601104-46601126 GCGAGCGCGCGCGCGCCCGGCGG + Intronic
1167495810 19:49818245-49818267 GCGCGCGCGCTCGCGTCGGGCGG - Intergenic
1168309369 19:55452770-55452792 GGGCGTGCGCGCGCCGGCTGGGG + Intergenic
1168408019 19:56120860-56120882 GCGCGCGCGTGCGCGTGGCGGGG - Intronic
1168721037 19:58555162-58555184 GCGCGCGTGCGCCCGTGCCCCGG + Intergenic
926020182 2:9487834-9487856 GCGCGCGCGCGCGCGCGCTGTGG + Intronic
926020184 2:9487836-9487858 GCGCGCGCGCGCGCGCTGTGGGG + Intronic
928093590 2:28391122-28391144 GCGCACGCGCGCGCGTCCTTGGG + Intergenic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
929974126 2:46616051-46616073 GCGCGCGCGCGCGTGGGCGGAGG + Intronic
931649374 2:64454398-64454420 GGGCGCGCGCGCGCGCGCCCGGG - Exonic
931867127 2:66425559-66425581 GCGCGCGCGCGCGCGCGTTCCGG - Intergenic
931869059 2:66440040-66440062 GCGCGCGCGCGCGTGTGTGTTGG - Intronic
932790194 2:74648313-74648335 GCGTGCGCCCGCGCGTTCGGAGG + Intronic
933206376 2:79512796-79512818 CCGCGGGCGCGCGCGGCCTGGGG - Intronic
935869550 2:107430794-107430816 ACGCGCGTGCGCACGTGCTACGG + Intergenic
937221746 2:120346068-120346090 GCGGGCGCGGGCGCGGGCGGGGG + Intergenic
937265688 2:120613497-120613519 GTGCACGCACGCGTGTGCTGGGG - Intergenic
944766645 2:202871470-202871492 GCGCGCGCGCGCGGCTTCTCGGG - Exonic
945033357 2:205684937-205684959 GTGTGCGCGCTCGCGCGCTGGGG - Intronic
947119236 2:226799129-226799151 GCGCGCGCGCGCTCCTGGAGGGG - Exonic
947958970 2:234218678-234218700 GCGCGTGTGCGCGCGTGTTTGGG + Intergenic
948118862 2:235514139-235514161 GCGCGCGCACGCGCATGCACTGG - Intronic
1171948238 20:31397361-31397383 GCACGCGCGTGCGCGTGCATAGG - Intergenic
1172489224 20:35321286-35321308 GCGCGCGCGCGCGCACGCTCAGG + Intronic
1172526579 20:35603358-35603380 GCGCGCGTGTGCGTGTGCAGGGG - Intergenic
1172529310 20:35619118-35619140 GCGCGGGGGCGCGGGGGCTGGGG - Intronic
1173807494 20:45935192-45935214 GTGCGCGCGCGCGCGCGCGCTGG + Intronic
1174467867 20:50731432-50731454 GCGCGCGCGCGGGCTCGCGGGGG + Intergenic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175911502 20:62407312-62407334 GCGCGCGGGCGCGCGGGCAGGGG - Intergenic
1176194569 20:63831293-63831315 GCGCGCGCGCGCGGGCGGCGGGG - Intergenic
1176194571 20:63831295-63831317 GGGCGCGCGCGCGCGGGCGGCGG - Intergenic
1176550496 21:8218949-8218971 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1176569424 21:8401986-8402008 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1176577338 21:8446219-8446241 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1181413296 22:22740185-22740207 GCGCGTGCGCGCGCGCTCTTTGG - Intronic
1181514369 22:23402677-23402699 GCGGGCGCGGGCCCGGGCTGGGG + Intergenic
1181572020 22:23772891-23772913 GGGCGCGCGCGGCCGCGCTGCGG - Exonic
1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG + Intronic
1181937932 22:26451979-26452001 GCGCGCGCGCGCGCGTAACGTGG - Exonic
1182586298 22:31346016-31346038 GCGCGCGCGCGCCTGCGCGGCGG - Exonic
1182586300 22:31346023-31346045 GCAGGCGCGCGCGCGCGCCGCGG + Exonic
1182709619 22:32312346-32312368 GTGCGCGCGCGCGTGTGATTTGG - Intergenic
1183683639 22:39349804-39349826 GCGCGGGGGCGCGCGTGCTGCGG - Intergenic
1183720129 22:39557763-39557785 GGGCGGGGGCGCGGGTGCTGCGG - Intergenic
1184893273 22:47392234-47392256 GAGCGCGTGCGTGCGTGGTGTGG - Intergenic
1185302540 22:50090029-50090051 GCGCGGGCGCGTGCGGGCGGCGG + Exonic
1203255393 22_KI270733v1_random:135290-135312 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
949522375 3:4868679-4868701 GCGTGCGCGTGCGCATGGTGGGG + Intronic
950345321 3:12287842-12287864 GCGGGCGCGGGCGCCGGCTGGGG - Intronic
950509990 3:13420285-13420307 GCGCGCGCGGGCGGGAGCGGAGG - Exonic
953925398 3:46980022-46980044 GCGCGCGGGCGCGCGCGCGCAGG + Intronic
954778974 3:53045659-53045681 GCCGGCGGGCGCGCGGGCTGAGG - Intronic
956179085 3:66500924-66500946 GCGCGCGCGCGCGCGCTCTCTGG - Exonic
956179087 3:66500933-66500955 GCGCGCGCGCGCGCAGCCTCGGG + Intronic
960047449 3:113211797-113211819 GGGCGCGTGCGGGCGTGTTGTGG - Exonic
960269453 3:115658536-115658558 GCGGGCTCGCGGCCGTGCTGCGG + Intronic
960702258 3:120450600-120450622 GCGGGTGGGCGCGCGTCCTGGGG - Intronic
962263113 3:133927527-133927549 GCGTGCGTGCGTGCGTGCGGTGG + Intergenic
962301954 3:134250862-134250884 GCGCGCACGGGCGCGTCCCGCGG - Intergenic
963236720 3:142963603-142963625 GCGCGCGGCCGCCCGCGCTGCGG + Exonic
963607240 3:147421621-147421643 GCGTGCGCGCGCGTGGCCTGAGG + Intronic
964430471 3:156600518-156600540 GCGCGCGCGCGCGCATGCACTGG + Intergenic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
966220655 3:177547886-177547908 GCGCGCGCGTGTGTGTGTTGTGG + Intergenic
966592230 3:181695790-181695812 ACGCGCGCGCGCGCGTTCTCGGG + Intergenic
966593003 3:181702016-181702038 GTGCGCGCGCGCGCATGGGGGGG - Intergenic
966787929 3:183636831-183636853 GCGCGCTCCCGCCCCTGCTGCGG + Intronic
968178192 3:196569048-196569070 GCGGGCGCGGGCGCGGGCTCGGG + Exonic
968584072 4:1407844-1407866 GAGCGCGCGGGCGCGTGCACCGG + Intergenic
969330323 4:6470946-6470968 GCGCGGGCGCGGGCGGGCTCGGG - Intronic
971195835 4:24471295-24471317 GCGCGCGCGCTCGCGTGTCTGGG - Intergenic
971308667 4:25505580-25505602 GCGCGCGCGTGCCCGGGATGAGG - Intergenic
973635876 4:52861959-52861981 GCGAGTGCGCGCGTGGGCTGTGG + Intergenic
976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG + Intronic
977184353 4:93917808-93917830 GCGCGCGCGCGCTCTAGCTCTGG + Intergenic
977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG + Intergenic
977908463 4:102502367-102502389 GCGCGCGCGCGCGCACGGAGGGG - Intronic
977908465 4:102502369-102502391 GCGCGCGCGCGCGCGCACGGAGG - Intronic
980013735 4:127623901-127623923 GCGCATGCGCGCGCGTGTTGGGG - Intronic
980130039 4:128809869-128809891 GCCCGCGCGCGTACCTGCTGCGG - Exonic
983937012 4:173509237-173509259 GCGCGCGCGTGCGGGAGCTTCGG + Intergenic
986976034 5:13395105-13395127 GTGTGCGCGCGCGCGTGCACTGG - Intergenic
986976046 5:13395291-13395313 GCGCGCGCGCACGCGCGCACTGG - Intergenic
987175437 5:15303434-15303456 GTGCGCGCGTGCGTGTGCTGAGG + Intergenic
987303420 5:16617006-16617028 GCGCGCGCGCGGGCGCGCCTGGG + Exonic
987901086 5:24013048-24013070 GTGCGCGCGCGCGCAGGCTGTGG + Intronic
993919148 5:93779127-93779149 GCGCGCGCGCGCACGTGCAGGGG + Intronic
996401473 5:123068115-123068137 GCACGCGCGCGTGTGTGGTGTGG + Intergenic
997237155 5:132279334-132279356 GCGCGCGCGCGTGGGTGTCGGGG - Intronic
997237158 5:132279342-132279364 GTGCGCGCGCGCGCGCGCGTGGG - Intronic
998083355 5:139294464-139294486 GCGCGCGCGCGCGTGTGGGCCGG - Intronic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
999330750 5:150672013-150672035 GCGCGTGCGCGTGTGTGTTGGGG - Intronic
1000071407 5:157743963-157743985 GCGCGGGCGCGGGCGGGCTCGGG + Exonic
1000907380 5:166978987-166979009 GCGCGCGCGCGTGTGTTGTGCGG + Intergenic
1002515250 5:179753223-179753245 GCGCGCGCGCGCGCGCGTGCTGG + Intronic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1002521758 5:179796260-179796282 GCGCGCGCGCTCGCGTACAGCGG - Exonic
1002580879 5:180208961-180208983 GCGCGGGCTCGCGGGGGCTGGGG - Intronic
1003604011 6:7542786-7542808 GCGCTCGCCCGCGGGGGCTGCGG - Intronic
1004767717 6:18749550-18749572 GCGCGCGCGCACGCGCGCGCAGG - Intergenic
1006125373 6:31834555-31834577 GCGCGCGCCCGCGCGCGCGCGGG + Intergenic
1006137242 6:31902397-31902419 ACGGGTGCGCGCGCGCGCTGCGG - Intronic
1006204686 6:32330042-32330064 GCGCGCGCGCACGTGTGTTGGGG + Intronic
1006271987 6:32972082-32972104 GAGCGAGCGCGCGCGCGCGGAGG + Exonic
1006271989 6:32972084-32972106 GCGAGCGCGCGCGCGCGGAGGGG + Exonic
1006606250 6:35259735-35259757 GCGCGCGGGCGGGCGGGCTATGG + Exonic
1007451313 6:41941776-41941798 CGGCGCGCGCGCGCGGGCGGCGG - Exonic
1010249879 6:73696313-73696335 GCGCGCGGGCGCGCGGGCCTGGG + Intronic
1011277301 6:85643347-85643369 GCCCGCGGGCGCGCGTCCCGAGG - Intronic
1012399523 6:98832711-98832733 GCGCGGGTGCGCGCGTGGTGGGG + Intergenic
1012872899 6:104693055-104693077 GTGCACGCGCGCGCGCGCTGGGG + Intergenic
1012886513 6:104852227-104852249 GTGCGCGCGTGCGCGTGCACGGG + Intronic
1013507567 6:110815234-110815256 GCGCGCGCGCGCGCGAGAGGCGG - Exonic
1013576054 6:111483844-111483866 GGGCGCGCGGGCGCGGGCTTCGG + Intergenic
1013836422 6:114341593-114341615 GCGCGCGCGCGCGTGTGTGTTGG + Intronic
1016308015 6:142703481-142703503 GTGCGTGCGCGCGCATGTTGCGG - Intergenic
1016823699 6:148368745-148368767 GCGCGTGCGCGCGCATGTGGGGG - Intronic
1017662418 6:156687422-156687444 GCGGGCGCGCGTGCGCGGTGCGG + Intergenic
1019282173 7:206036-206058 GAGGGCACGCGCGTGTGCTGAGG - Intronic
1019619444 7:1983125-1983147 GCGCGCGCGCGCGCGTCTGTGGG - Intronic
1019703302 7:2485140-2485162 GCGCGCGCGCGCGCGTGTGAGGG - Intergenic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1023315746 7:38934586-38934608 GCACGCGTGCACGTGTGCTGGGG - Intergenic
1023812923 7:43926417-43926439 GCGCGCGCAAGCGCAGGCTGCGG + Intronic
1023945122 7:44796898-44796920 GGGCGAGCGCGGGCGGGCTGCGG + Intronic
1029496324 7:100896987-100897009 GCGTGCGTGCGCGCGCGCGGCGG + Intergenic
1029536992 7:101162942-101162964 GCGCCGGCGCGCGCGCGCGGCGG + Exonic
1031213281 7:118858667-118858689 GAGCGCGCGCGCGCGCGCGTGGG - Intergenic
1031400851 7:121325113-121325135 GTGCGCGCGCGCACATGGTGGGG - Intergenic
1032013411 7:128360970-128360992 GTGTGCGCGCGCGCGTGCAGGGG - Intronic
1033927025 7:146474982-146475004 GCGCGTGCGCGCTCGTGCTCAGG - Intronic
1034147328 7:148884468-148884490 GCGCGTGCGCGCGCGGGCGGCGG + Intergenic
1035417927 7:158705059-158705081 GCGCGCTCGTGCGCGTCCTGGGG + Intergenic
1036664516 8:10730165-10730187 GCGCGCGGCCGAGCGGGCTGGGG - Intronic
1036930600 8:12951950-12951972 GGGAGCGCGCGCGCGGGCCGGGG - Intronic
1037878411 8:22560871-22560893 GTGCGCGCGCGCACGCGCCGTGG + Intronic
1037878413 8:22560873-22560895 GCGCGCGCGCACGCGCCGTGGGG + Intronic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1037900478 8:22685429-22685451 GCGCGCGCGCGCGCGCGGGGAGG + Intergenic
1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG + Intergenic
1037901039 8:22689991-22690013 GCAGGCGCGCGTGCGTGCGGCGG + Exonic
1038767909 8:30446841-30446863 GTGCGCGCGCGCGCGCGCGGTGG + Intronic
1039595454 8:38787133-38787155 GCGCGCGCGCGCGGGGGCGGCGG - Intronic
1039595460 8:38787144-38787166 GCGCGCGCGCGCGAGTAGTACGG + Intronic
1039903265 8:41767661-41767683 GCGCGCGGGGGCGCGGGCGGGGG + Intronic
1041369477 8:57143520-57143542 GCACGGGCGCGCACGGGCTGGGG + Intergenic
1041689909 8:60678740-60678762 GCGCAGGCGCTGGCGTGCTGGGG + Intergenic
1042962945 8:74321704-74321726 CCGCGCGCGCCCGCCTGCCGAGG - Intronic
1043464708 8:80493186-80493208 GCGCGCGCGCGCGCGTTTTGAGG - Intronic
1044115311 8:88327743-88327765 GCGCGCGCGCGCGCGCGCCAAGG - Intronic
1044719694 8:95133762-95133784 GCGCGCCCGTGCGCGCGCAGGGG + Intergenic
1049719268 8:144108134-144108156 GCGCCCGCGCCCGCCGGCTGTGG + Exonic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1050445787 9:5721433-5721455 GTGCACGCGCGTGTGTGCTGGGG - Intronic
1051206406 9:14693403-14693425 GCCCGCGCGCCCGCGTGGGGAGG + Exonic
1051780495 9:20684120-20684142 ACGCGCGTGCGCGCGAGCCGGGG + Intronic
1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG + Intergenic
1054842663 9:69760020-69760042 GCGCGCGCGCGCGGGTGCTTCGG + Intergenic
1055158921 9:73100353-73100375 GCGCGCGCGCGCGCGTGCATAGG + Intergenic
1056078371 9:83063369-83063391 GCGCGCGCCAGCACGTTCTGTGG - Intergenic
1057361188 9:94374894-94374916 GCGCGCGGGCGCGCAGGCCGCGG + Exonic
1057619106 9:96619421-96619443 GCGCGCCCGCGCGCCCGCCGAGG + Exonic
1057662175 9:97013270-97013292 GCGCGCGGGCGCGCAGGCCGCGG - Exonic
1057995914 9:99821683-99821705 GCGCGCGCGCGCGCGTTCCTCGG - Intergenic
1058058551 9:100473242-100473264 GCGGGCGGGCGCGCGCGCGGCGG - Exonic
1058602538 9:106685482-106685504 ACGCGCGCGCGCGCGCGCACAGG - Intergenic
1059269328 9:113062085-113062107 GTGTGCGCGCCCGCGTGCTTGGG + Intergenic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059790036 9:117632133-117632155 GCGCGCGCGCGCGTGTATTGGGG - Intergenic
1059790038 9:117632135-117632157 GCGCGCGCGCGCGCGTGTATTGG - Intergenic
1060283373 9:122228490-122228512 GCGCGCGCGCGAGCGGGGGGGGG - Intronic
1060283377 9:122228494-122228516 GGGAGCGCGCGCGCGAGCGGGGG - Intronic
1203471789 Un_GL000220v1:118423-118445 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1187067551 X:15855069-15855091 GCGCGGGCGCGCGGGCGCTCGGG - Intergenic
1189310604 X:40014818-40014840 GCGCGCGCGCGCTCGTGGAGCGG - Intergenic
1190862635 X:54358648-54358670 GCCCCCGCGCGCGCGCACTGCGG - Intergenic
1195316844 X:103687494-103687516 GCACGCGCGCGCGCCCGCCGTGG - Intronic
1197735083 X:129844189-129844211 GCGCGCGCGCGCGTGTGTGTAGG - Intergenic
1197782488 X:130171888-130171910 GTGCGCGCGCGCGCGTGAAGGGG - Exonic
1198517483 X:137424656-137424678 GCGCGCCCGCGCGCGTTCGCGGG - Intergenic
1198767159 X:140091569-140091591 GCGGGCGGGCGCGCGGGCGGCGG - Intergenic
1199086454 X:143634724-143634746 GCGCGCGCGCACGCGAGCCGAGG - Intronic
1199760116 X:150898700-150898722 CCGCGCGCGCGCGCGGGCTTTGG - Exonic
1199760118 X:150898705-150898727 GCCCGCGCGCGCGCGCGGCGCGG + Exonic
1200092674 X:153643220-153643242 GCAGGTGTGCGCGCGTGCTGGGG - Intronic
1200233540 X:154457985-154458007 GCGCGGGCGCGCGCGGGTTCCGG + Intergenic
1200233542 X:154457987-154458009 GCGGGCGCGCGCGGGTTCCGGGG + Intergenic