ID: 1002515252 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:179753225-179753247 |
Sequence | GCGCGCGCGCGCGCGTGCTG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 374 | |||
Summary | {0: 1, 1: 8, 2: 12, 3: 73, 4: 280} |
Found 0 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary |
---|
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1002515252 | Original CRISPR | GCGCGCGCGCGCGCGTGCTG GGG | Intronic | ||