ID: 1002517712

View in Genome Browser
Species Human (GRCh38)
Location 5:179772041-179772063
Sequence CAGACCCATCTGACATTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002517710_1002517712 -7 Left 1002517710 5:179772025-179772047 CCATGTTTTCTGCCTTCAGACCC 0: 1
1: 0
2: 0
3: 40
4: 336
Right 1002517712 5:179772041-179772063 CAGACCCATCTGACATTTTGTGG 0: 1
1: 0
2: 1
3: 9
4: 166
1002517709_1002517712 -6 Left 1002517709 5:179772024-179772046 CCCATGTTTTCTGCCTTCAGACC 0: 1
1: 0
2: 3
3: 25
4: 257
Right 1002517712 5:179772041-179772063 CAGACCCATCTGACATTTTGTGG 0: 1
1: 0
2: 1
3: 9
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002517712 Original CRISPR CAGACCCATCTGACATTTTG TGG Intronic
902081096 1:13821035-13821057 CAGCCCCATCAGACATTTCAGGG + Intronic
906003533 1:42448035-42448057 AAACTCCATCTGACATTTTGGGG + Intronic
909711553 1:78655840-78655862 GAGATCCTTCTGACTTTTTGAGG + Intronic
911088332 1:93998182-93998204 TAGACTCATCAGAAATTTTGGGG + Intronic
912785219 1:112596325-112596347 CAGACCCTTCAGTGATTTTGTGG + Intronic
916275285 1:162987383-162987405 CAAACCCATTTAAGATTTTGGGG - Intergenic
917113164 1:171573412-171573434 CTGTACCATCTGAGATTTTGTGG - Intronic
924737463 1:246771015-246771037 AAGACCCATCAGTCAATTTGTGG + Intergenic
1062922315 10:1289576-1289598 CAGACCCATCCCACTTTCTGAGG + Intronic
1066347495 10:34602914-34602936 CATACACATTTGACATTTTTTGG - Intronic
1071049417 10:81428416-81428438 CAGAAAACTCTGACATTTTGAGG - Intergenic
1073103397 10:101018821-101018843 CAGAGCTATCTGACCTTGTGGGG - Exonic
1075964863 10:126602693-126602715 AAGACCCATCTTGCTTTTTGAGG - Intronic
1078178595 11:8990168-8990190 CAGCAGGATCTGACATTTTGTGG - Intronic
1079308461 11:19344939-19344961 CAGACGCACCTGACACTTTAAGG - Intergenic
1080085867 11:28281281-28281303 GAGCCCCATCTGAAATTCTGGGG + Intronic
1081950917 11:47041756-47041778 CAAAACCATCTGAGATGTTGTGG + Intronic
1085447431 11:76610161-76610183 CAGAGGCAACTGACTTTTTGGGG + Intergenic
1087340933 11:96906119-96906141 CAGTATCATTTGACATTTTGGGG + Intergenic
1087577819 11:100011569-100011591 CAAACTCATCTGAAATCTTGTGG + Intronic
1089818085 11:121194602-121194624 TAGAACCATTTGACATTTAGTGG + Intergenic
1095266158 12:40160635-40160657 CAGACCTGTCTCAAATTTTGGGG - Intergenic
1096896553 12:54826459-54826481 CAGACTCAACTGGTATTTTGGGG + Intergenic
1100082064 12:90864516-90864538 TAGACACAACTCACATTTTGTGG + Intergenic
1101958335 12:109229831-109229853 CAGACACATCAGATATTTTTAGG - Intronic
1101964650 12:109274214-109274236 CAGATCCATCTGGGATTCTGAGG - Intergenic
1102563822 12:113781552-113781574 CATACCAAGCTGAGATTTTGAGG - Intergenic
1102791931 12:115653822-115653844 CAGTCACATTGGACATTTTGAGG - Intergenic
1107390889 13:39962943-39962965 CAGACCCATCAGTCATTTAACGG - Intergenic
1108172813 13:47760807-47760829 CAGCACCAGCTGACATCTTGAGG - Intergenic
1108316848 13:49244807-49244829 GAGACCCGTCTTAGATTTTGGGG + Intergenic
1108683247 13:52797494-52797516 CAGACCAAACTGGCATTTAGAGG + Intergenic
1111879408 13:93936916-93936938 GAAACCCATCAGATATTTTGTGG + Intronic
1113119249 13:106908759-106908781 CCAACTCATCTGACATTATGAGG + Intergenic
1115838341 14:37435322-37435344 CAGACTCATGTGACATTCCGGGG - Intronic
1116418175 14:44703597-44703619 CAGAATCTCCTGACATTTTGAGG + Intergenic
1118666232 14:68073414-68073436 CAGACCCATCTCACATACAGTGG - Intronic
1120986127 14:90336571-90336593 CAGCCCCATCTGACAGGTTAGGG + Intergenic
1124108596 15:26764971-26764993 CACACCCAGCTAACTTTTTGTGG - Intronic
1126707132 15:51416008-51416030 GAGACCTATCTCAAATTTTGGGG - Intergenic
1127842197 15:62841216-62841238 CAGACCCATCTTGTATTTTGTGG + Exonic
1129231082 15:74197530-74197552 CACACTCATGTGACATCTTGGGG + Intronic
1131002231 15:88948276-88948298 CATACCAATGTGGCATTTTGGGG + Intergenic
1131028686 15:89167970-89167992 CTTATCCACCTGACATTTTGTGG + Intronic
1131078530 15:89514623-89514645 CAGATCCATTTGCCATTTGGGGG - Intergenic
1131161412 15:90107274-90107296 CAGACCCAACTCACACTTGGTGG + Intergenic
1131450588 15:92536208-92536230 GAGACCCACCTGAAATTTTCAGG + Intergenic
1132813296 16:1812575-1812597 CAGATCCAGCAGACATTTGGGGG + Intronic
1135837698 16:25841985-25842007 CAGCACCATCTGGCACTTTGGGG + Intronic
1140667291 16:77239238-77239260 CAAATCCTTCTGTCATTTTGAGG + Intergenic
1142733198 17:1877053-1877075 CAAACCCATGTGTCATCTTGGGG + Intronic
1150363051 17:64554618-64554640 CAGGCCTAGCTGACATCTTGTGG + Intronic
1152692289 17:81724586-81724608 CACACCCTTCTGACTTTATGGGG - Intergenic
1155984709 18:32217957-32217979 CAGCCTCAACTTACATTTTGCGG - Exonic
1156544074 18:37946358-37946380 CAGAGCCATCTGATAATTTTTGG - Intergenic
1157946909 18:51990863-51990885 CAGAACCACATCACATTTTGAGG - Intergenic
1158273890 18:55745821-55745843 CAAATCCCCCTGACATTTTGAGG + Intergenic
1159843585 18:73430148-73430170 CAGAGCCATCAGATATTTTATGG - Intergenic
1163293867 19:16399329-16399351 CAGACCCATCTGCCAACTTGGGG + Intronic
1163517470 19:17773809-17773831 CAGATCCAGGTGCCATTTTGTGG + Intronic
1164554196 19:29237812-29237834 CAGGCTGGTCTGACATTTTGGGG - Intergenic
1164995657 19:32719334-32719356 GAGACCTATCTCACATTTTCAGG + Intergenic
1168393576 19:56030070-56030092 CAGCCCCATGTGATAATTTGAGG - Intronic
924980952 2:221217-221239 CAGACCAAACTGACATTTATCGG + Intronic
928123048 2:28597860-28597882 CAGACCCATCTCTGAGTTTGAGG - Intronic
929736472 2:44555369-44555391 CAGACACATCTGACGGTTTCTGG + Intronic
929947652 2:46382585-46382607 CACACCCACCTGACACCTTGTGG - Exonic
931037456 2:58259317-58259339 TAGGCACATTTGACATTTTGGGG - Intergenic
931407347 2:61992396-61992418 ATGTCCCATCTGACATTGTGTGG - Intronic
932305518 2:70699446-70699468 CATTGCCATCTGACATTCTGTGG - Intronic
933228682 2:79780478-79780500 CAGACCCCTCTGAGATTCTGAGG + Intronic
934108358 2:88717221-88717243 GGGACCTATCTCACATTTTGGGG - Intronic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
934979844 2:98830772-98830794 CAAACCCATGTGACACTATGAGG - Intronic
936952983 2:117996966-117996988 CAGTACCATCCGACATTGTGAGG - Intronic
937653945 2:124353086-124353108 GAGCCCCAGCTGACATCTTGTGG + Intronic
937896232 2:126978582-126978604 CTGAGTCATTTGACATTTTGTGG + Intergenic
940149076 2:150578948-150578970 CAAAGGCATTTGACATTTTGTGG - Intergenic
940987797 2:160065738-160065760 GAGGCCCATCTCAAATTTTGGGG - Intergenic
941152501 2:161932343-161932365 CAGACCAAATTGACACTTTGAGG + Intronic
941864039 2:170315016-170315038 CGGACCCAATTGACATTTTTAGG + Intronic
942744317 2:179214229-179214251 GAGACCCATCTCACATGTAGAGG + Intronic
944678622 2:202055474-202055496 CAGACTCATCTGACAGCCTGGGG - Intergenic
945913520 2:215677648-215677670 CCAACCCATCTGCTATTTTGAGG - Intergenic
945949014 2:216021302-216021324 CACACCCAGCTAATATTTTGGGG + Intronic
1168969383 20:1920312-1920334 CACACCCATCAAACATTTTGAGG - Intronic
1169095382 20:2893599-2893621 CAGATCCATATACCATTTTGGGG - Intronic
1173640051 20:44595263-44595285 CAGACACATTTGAGAGTTTGAGG - Intronic
1174897495 20:54466407-54466429 CAGACCCATTTGCAATTTTAGGG - Intergenic
1178360257 21:31943432-31943454 CAGACCCATGTGACATTGCTGGG + Intronic
1178505663 21:33161009-33161031 TAGACCCATCTAACATTAGGTGG + Intergenic
1179912871 21:44459633-44459655 CAGTCCCATCTCGCATTTTGGGG + Exonic
1182121540 22:27790443-27790465 CAGAACCATCTCTCCTTTTGAGG + Intronic
950336270 3:12196354-12196376 CTGATTCATCTGTCATTTTGTGG + Intergenic
951364019 3:21758504-21758526 GAGACACATCAGAAATTTTGTGG + Intronic
951404047 3:22272074-22272096 GAGACACATATGGCATTTTGTGG - Intronic
951549626 3:23863862-23863884 CAGAGCCATCTGACCTCTTCTGG + Intronic
953145144 3:40268070-40268092 AAGAGCCATGTGACATTATGAGG + Intergenic
955057881 3:55472405-55472427 CAGACACATCTCTCTTTTTGAGG + Intronic
955779874 3:62472994-62473016 CAGACCTATCTGAAATTCTTGGG + Intronic
958765865 3:98367492-98367514 GAGACCTATCTCACATTTTGGGG + Intergenic
959462647 3:106645327-106645349 CAGAATCATAAGACATTTTGTGG + Intergenic
966045360 3:175542359-175542381 CAGATACATATGACAATTTGGGG - Intronic
966791401 3:183673655-183673677 CAGAACCATCAAGCATTTTGGGG - Intronic
966975757 3:185082014-185082036 CAGCCACATCTGACATCTTAAGG - Exonic
967718684 3:192791848-192791870 CAGACTCATCTGATCTTTTGTGG - Intergenic
968294793 3:197567692-197567714 GAGACCTGTCTGAGATTTTGGGG + Intronic
970120456 4:12747282-12747304 CAGCTCCCTCTGACCTTTTGGGG + Intergenic
970925838 4:21451237-21451259 CTTTCCCATCTGGCATTTTGTGG + Intronic
971660162 4:29403869-29403891 CAGACAGTGCTGACATTTTGAGG + Intergenic
972822855 4:42722366-42722388 CAGAAACACATGACATTTTGAGG - Intergenic
975871027 4:78778182-78778204 AAGACCCATCTGGGATTTAGTGG - Intronic
982431851 4:155331859-155331881 CAGTCCCTTCTGACCTTTTCTGG - Intergenic
982538239 4:156634055-156634077 CACACACATCTGCCATATTGAGG - Intergenic
982704500 4:158692474-158692496 CAGAATCATGTGACATCTTGGGG + Intronic
983406845 4:167342081-167342103 CTGACCTACCTGACATTTAGAGG + Intergenic
986562691 5:9078563-9078585 CATACCCAGCTGAAATTTTCTGG - Intronic
987490978 5:18579837-18579859 CAGACCAGTATGACATATTGTGG + Intergenic
988439140 5:31212236-31212258 CAGAAACATCTGACATTTTGGGG - Intronic
992592281 5:78307588-78307610 GAGACCTATCTTAGATTTTGGGG + Intergenic
998582034 5:143386545-143386567 CAGACACATATGAGATTTTCTGG - Intronic
1001042657 5:168348119-168348141 CAGCCCCATTTGACAGGTTGGGG + Intronic
1001616137 5:173045113-173045135 AAGAACCATGTGACCTTTTGGGG - Intergenic
1002517712 5:179772041-179772063 CAGACCCATCTGACATTTTGTGG + Intronic
1003691941 6:8363596-8363618 CTGACTCACCTGACATCTTGAGG - Intergenic
1004648357 6:17584828-17584850 GAGACCAATGTGACATCTTGGGG + Intergenic
1005709979 6:28494823-28494845 CAAACCCATCCTACATTTTAAGG - Intergenic
1005891525 6:30144129-30144151 CAGCCCCAACTGACATTGTCCGG - Intronic
1006478611 6:34273866-34273888 AAGAGCCAAATGACATTTTGGGG - Intergenic
1007198574 6:40085402-40085424 AAGATCCAACTGACAGTTTGTGG + Intergenic
1012747698 6:103115684-103115706 CAGGCCCATCTCTAATTTTGGGG - Intergenic
1016332373 6:142967222-142967244 CAGTCCCAGCTAACATTATGTGG - Intergenic
1018280144 6:162176617-162176639 CAGATACATCTGACATCTAGAGG + Intronic
1018713786 6:166516162-166516184 GAGACCTGTCTGAGATTTTGGGG + Intronic
1024762720 7:52619448-52619470 CAGAGCTCTTTGACATTTTGAGG - Intergenic
1025004961 7:55346195-55346217 CACAGCCATCTGAATTTTTGAGG - Intergenic
1026656911 7:72264656-72264678 CACACCCAGCTGATTTTTTGTGG + Intronic
1029871489 7:103697572-103697594 GAGACACATCTGCCTTTTTGTGG + Intronic
1030559517 7:111066734-111066756 CAGACACTCCTGACATTTCGGGG - Intronic
1036178036 8:6557881-6557903 CAGGCCCTGCTGTCATTTTGTGG + Intronic
1039818137 8:41112844-41112866 CAGTCCATTCTCACATTTTGTGG - Intergenic
1042082806 8:65073987-65074009 CATATATATCTGACATTTTGAGG + Intergenic
1043803602 8:84643195-84643217 CAGACTCAGCTGACTTTTGGGGG - Intronic
1044468013 8:92529377-92529399 CTGAGTCATCTGAAATTTTGTGG + Intergenic
1045627361 8:104070573-104070595 TAGACACACCTGACCTTTTGTGG + Intronic
1045990920 8:108306720-108306742 CAGTCCTACCTGGCATTTTGAGG + Intronic
1048598250 8:135889826-135889848 CAAAACCATCTAGCATTTTGAGG - Intergenic
1048744776 8:137601763-137601785 CAAAGCGATCTGACATTTAGAGG + Intergenic
1050252025 9:3755035-3755057 CAAAACCATCTAACATTTTGGGG - Intergenic
1051391317 9:16567163-16567185 CAGACTCAAGTGTCATTTTGGGG - Intronic
1051745356 9:20290317-20290339 CATACCCATCTGCCATGTTGAGG + Intergenic
1051983227 9:23049559-23049581 CAGACCTGTCTCAGATTTTGAGG - Intergenic
1052084393 9:24246949-24246971 CAGACCCTCTGGACATTTTGAGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1057235643 9:93356833-93356855 GAGACCCGTCTCAAATTTTGGGG + Intergenic
1057283197 9:93727284-93727306 CAGACCCATGTGATACTCTGAGG + Intergenic
1057289143 9:93789333-93789355 CAGAGCCAGTGGACATTTTGGGG - Intergenic
1060989097 9:127838217-127838239 CAGAGCCATTTGGGATTTTGGGG + Intronic
1186440283 X:9580172-9580194 GAGACCCGTCTCAGATTTTGGGG - Intronic
1186846869 X:13539614-13539636 CAGCCACATCTGCCATGTTGGGG - Intergenic
1191769577 X:64740679-64740701 TAGACCAATGTGATATTTTGTGG + Intergenic
1193178951 X:78430736-78430758 AAAACCCAACTGACATGTTGTGG - Intergenic
1193517132 X:82479623-82479645 CAGACTACTCTGCCATTTTGTGG - Intergenic
1194534049 X:95084418-95084440 GAGACCTATCTCAAATTTTGGGG - Intergenic
1199025510 X:142932580-142932602 GAGACCTGTCTGAGATTTTGGGG - Intergenic
1199274045 X:145921695-145921717 CAGGCCCCTCTGTCTTTTTGGGG - Intergenic
1199574544 X:149300821-149300843 CAGACCCAGGTGAGATTCTGTGG + Intergenic
1200383949 X:155869925-155869947 GAGACCTGTCTGACATTTTCTGG - Intergenic
1202118056 Y:21493221-21493243 TTGACCCATCACACATTTTGTGG - Intergenic
1202342815 Y:23887669-23887691 CAAACCCAGCTGTCATTGTGGGG - Intergenic
1202527953 Y:25782416-25782438 CAAACCCAGCTGTCATTGTGGGG + Intergenic