ID: 1002521196

View in Genome Browser
Species Human (GRCh38)
Location 5:179794065-179794087
Sequence CCACACCGACGGTACCATGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 35}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002521189_1002521196 7 Left 1002521189 5:179794035-179794057 CCAGCTCGCCTTCACACACAGCC 0: 1
1: 0
2: 2
3: 19
4: 237
Right 1002521196 5:179794065-179794087 CCACACCGACGGTACCATGAAGG 0: 1
1: 0
2: 1
3: 1
4: 35
1002521190_1002521196 -1 Left 1002521190 5:179794043-179794065 CCTTCACACACAGCCCGTGCCAC 0: 1
1: 0
2: 3
3: 31
4: 271
Right 1002521196 5:179794065-179794087 CCACACCGACGGTACCATGAAGG 0: 1
1: 0
2: 1
3: 1
4: 35
1002521187_1002521196 9 Left 1002521187 5:179794033-179794055 CCCCAGCTCGCCTTCACACACAG 0: 1
1: 1
2: 0
3: 18
4: 224
Right 1002521196 5:179794065-179794087 CCACACCGACGGTACCATGAAGG 0: 1
1: 0
2: 1
3: 1
4: 35
1002521188_1002521196 8 Left 1002521188 5:179794034-179794056 CCCAGCTCGCCTTCACACACAGC 0: 1
1: 0
2: 1
3: 8
4: 215
Right 1002521196 5:179794065-179794087 CCACACCGACGGTACCATGAAGG 0: 1
1: 0
2: 1
3: 1
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002521196 Original CRISPR CCACACCGACGGTACCATGA AGG Exonic
920668669 1:207986213-207986235 CCACACAGACGGCAGCATGCAGG + Intergenic
920697203 1:208190041-208190063 CCACACCGAAGTCACCCTGAAGG + Intronic
1063914771 10:10870453-10870475 CCACACCGGCGTTTCCATGAGGG - Intergenic
1072713679 10:97735291-97735313 CCACACTGAGGGTACCACTATGG + Intergenic
1075038717 10:119090638-119090660 CCACACCGTCGGAACCACCAAGG - Intergenic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1107053927 13:36082590-36082612 CCAGACTGACGGCATCATGAAGG + Intronic
1119976373 14:79028826-79028848 GCATACAGAAGGTACCATGAAGG + Intronic
1130298423 15:82663121-82663143 ACTCACCGACGGTACCAGGGTGG + Exonic
1137689341 16:50410643-50410665 CCACAGCGACAGTAACCTGAGGG + Intergenic
1140780503 16:78292217-78292239 CCAGACTGATGGTGCCATGAGGG + Intronic
1140988125 16:80178937-80178959 ACACACAGATGGTAGCATGAAGG - Intergenic
1144154690 17:12487884-12487906 CCACGGTCACGGTACCATGAGGG - Intergenic
1145018145 17:19412103-19412125 CCACCCCAACGGCCCCATGAGGG + Intronic
1150265112 17:63827341-63827363 CCACACTAAGGGAACCATGATGG - Exonic
1151933901 17:77249536-77249558 CCACACTGACAGTGCCCTGATGG + Intergenic
1162382452 19:10339588-10339610 CAACACGGATGGTACCATGGTGG + Exonic
932921101 2:75916408-75916430 CCACACCCACTGGCCCATGAGGG + Intergenic
933858649 2:86442203-86442225 CCACACCGACGTTACCAAGAAGG + Exonic
934464225 2:94244650-94244672 CCACACCAACAATTCCATGAGGG - Intergenic
947188080 2:227472529-227472551 CCCCACCTACGTTAACATGACGG + Exonic
1171152473 20:22839258-22839280 ACACACCGACATCACCATGAAGG - Intergenic
1173902978 20:46604596-46604618 GTACACCGTTGGTACCATGAGGG + Intronic
1185356524 22:50375500-50375522 CCACACCGATGGAACTCTGAAGG + Intronic
954098754 3:48353176-48353198 CCACACCTAAGGTAACATCAAGG + Intergenic
968329244 3:197850758-197850780 CCATTCCGACGTTACAATGATGG - Intronic
968881961 4:3305558-3305580 CCACAGCCACGGTGCCATCATGG + Intronic
996611691 5:125388944-125388966 CAAGACTGACGGTGCCATGAGGG + Intergenic
999026519 5:148238582-148238604 AACCACTGACGGTACCATGAGGG + Intergenic
1002521196 5:179794065-179794087 CCACACCGACGGTACCATGAAGG + Exonic
1002574934 5:180169354-180169376 CCAAACAGAGGGAACCATGAAGG - Intronic
1008168292 6:48168061-48168083 CCACACCTATGGTACTATTAGGG - Intergenic
1019660258 7:2220068-2220090 CCACCCCAATGCTACCATGACGG + Intronic
1019693507 7:2431580-2431602 CCACACTGACAGTACCCTGGTGG + Intronic
1026832241 7:73617353-73617375 CCAAAAGGACTGTACCATGAAGG - Intronic
1056437811 9:86590109-86590131 CCTCACCGCCGATGCCATGATGG - Intergenic
1062588872 9:137263990-137264012 CCACACTCAGGGTGCCATGAAGG + Intronic
1199787366 X:151117270-151117292 CCACACGGAAGGGACCCTGATGG + Intergenic