ID: 1002522351

View in Genome Browser
Species Human (GRCh38)
Location 5:179798758-179798780
Sequence AGGCAGCCCCTAGGAGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 6, 3: 48, 4: 283}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002522351_1002522357 12 Left 1002522351 5:179798758-179798780 CCCTGAGCTCCTAGGGGCTGCCT 0: 1
1: 0
2: 6
3: 48
4: 283
Right 1002522357 5:179798793-179798815 ACAAGGTAGCTACCATTACGAGG 0: 1
1: 0
2: 1
3: 3
4: 33
1002522351_1002522354 -5 Left 1002522351 5:179798758-179798780 CCCTGAGCTCCTAGGGGCTGCCT 0: 1
1: 0
2: 6
3: 48
4: 283
Right 1002522354 5:179798776-179798798 TGCCTGACTTAGTCCTCACAAGG 0: 1
1: 0
2: 1
3: 14
4: 165
1002522351_1002522359 28 Left 1002522351 5:179798758-179798780 CCCTGAGCTCCTAGGGGCTGCCT 0: 1
1: 0
2: 6
3: 48
4: 283
Right 1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG 0: 1
1: 0
2: 0
3: 6
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002522351 Original CRISPR AGGCAGCCCCTAGGAGCTCA GGG (reversed) Intronic
900136660 1:1120514-1120536 AGTCAGGGCCGAGGAGCTCAGGG - Intergenic
900179631 1:1305535-1305557 TGGCTGCACCCAGGAGCTCACGG + Intronic
900363557 1:2301369-2301391 AGGCAGCCCCTGAAGGCTCACGG - Intronic
900519511 1:3098807-3098829 ATGCAGCGCCCAGGAGCCCAAGG - Intronic
900569100 1:3349624-3349646 AGGCAGCCCGGCAGAGCTCAGGG + Intronic
900815596 1:4841388-4841410 AGCCAGCTCCTAGGAGCTGAGGG + Intergenic
901677853 1:10897384-10897406 AGGCAGCCTCCAGGAGCAGAGGG - Intergenic
901794339 1:11671836-11671858 TGGCAGCCCCTGTGAGCCCAGGG - Intronic
901962419 1:12838116-12838138 AGGCCTTCCCTAGGAGCACATGG + Intergenic
902950390 1:19878066-19878088 AGGCAGCCCCTAGTACCTTACGG - Intergenic
902988639 1:20171060-20171082 AGCCAGCCCACAGGAGCCCAGGG + Intronic
905281243 1:36850722-36850744 AGGCAGCCCCAGGGGTCTCAGGG + Intronic
906057989 1:42930905-42930927 ACCCAGCCCCTCGGAGCCCAAGG - Intronic
908510396 1:64846331-64846353 AGTCAGGCCCAAGGAGCTCTGGG - Intronic
914741090 1:150465649-150465671 ATGCAGCCCCTAGGGTGTCATGG - Intronic
915731124 1:158055249-158055271 AGTCAGGCTCTAGGAGCTCTGGG - Intronic
916206454 1:162320074-162320096 AGACTGCCCTGAGGAGCTCAGGG - Intronic
916280809 1:163049035-163049057 AGGCAGAACCTGGGAGCACAAGG + Intergenic
916301790 1:163283759-163283781 AGACAGCCTTTAGGAGCTGAGGG + Intronic
916793173 1:168142045-168142067 AGGCAGCCTCTGGGAGCAGAGGG - Intergenic
918099034 1:181357551-181357573 AGGCAGCCTCTGTGAGTTCAGGG + Intergenic
919312853 1:195933195-195933217 GGGCAACCTCTAGGAGCTAAGGG - Intergenic
919746963 1:201014662-201014684 AGCCAACCCCTAGGAGTCCAAGG - Intronic
920060400 1:203223305-203223327 AGGCAGCCCCTGTGAGCCCCAGG + Intronic
921050500 1:211507937-211507959 AGACAGCCTCTAGGAGCTGATGG + Intergenic
922616547 1:226964443-226964465 TGGCCGTCCCTAAGAGCTCAGGG - Intronic
922746514 1:228047303-228047325 AAGCAGGCCCGAGGGGCTCAGGG + Intronic
1062932885 10:1364067-1364089 AGGGAGCCCCTGGGAGCCTATGG + Intronic
1067053636 10:43039111-43039133 AGGGAGCCTGGAGGAGCTCAGGG - Intergenic
1067058667 10:43066623-43066645 ACCCAGCCACTGGGAGCTCATGG + Intergenic
1072810032 10:98454420-98454442 AGGCAGCCCCTGTGAGCGCTGGG - Intergenic
1074539149 10:114350644-114350666 AGGCAGCCCCTGGCAGCTGATGG + Intronic
1074760093 10:116660999-116661021 AGATAGCTCCTAGGGGCTCAAGG - Intergenic
1075723590 10:124600688-124600710 AGGCAGGCCCCTGGGGCTCAGGG - Intronic
1078269389 11:9780863-9780885 AGGCATCCCCCTGGAGCACAAGG - Intronic
1081128440 11:39347574-39347596 GGGTAGCCTCTAGGAGCTGAAGG + Intergenic
1083197330 11:61096350-61096372 AAGCACCCCCAAGGAGCCCAAGG + Intergenic
1083692655 11:64419702-64419724 AGGGAGCACCTGGGAGCCCAGGG - Intergenic
1083852874 11:65378150-65378172 CCTCAGCCCCCAGGAGCTCAGGG - Intronic
1083855948 11:65393172-65393194 AGGCAGCCCCTTGGGCCTCTGGG + Intronic
1084499182 11:69524923-69524945 TGGAAGCCCCAAGGAGCTCACGG + Intergenic
1085694453 11:78692086-78692108 AGGCAGCCACTTGGAGCCCAGGG - Intronic
1085698864 11:78728812-78728834 AGCCAGCCCCTGGAAGCCCAAGG + Intronic
1088818509 11:113437618-113437640 AGGGAGCTCCGAGGAGCACAGGG + Intronic
1091013179 11:132024931-132024953 ATGAAGCCACTAGGATCTCAGGG - Intronic
1091206094 11:133822197-133822219 AGCAAGGCCCTAGGAACTCACGG + Intergenic
1091283593 11:134396000-134396022 AAGCAGCCCCCAGGAGCTGAGGG - Intronic
1091297294 11:134482963-134482985 AGGCTGCCCAGAGGGGCTCAAGG + Intergenic
1091511383 12:1130473-1130495 ATGCAGCCCCAAGGAACTCTTGG - Intronic
1091702551 12:2673688-2673710 AGGCAGCCTCTAGGAGCAGAGGG - Intronic
1091965307 12:4735723-4735745 TGGCAGCCCCCTGGAGCTCCTGG - Intronic
1094581855 12:31740631-31740653 AGGCAGCCTCTCAGAGCTGAGGG - Intergenic
1096723337 12:53540831-53540853 AGGCTGAGCCTAGGAGGTCAAGG - Intronic
1096872759 12:54604477-54604499 ATCCAACCCCAAGGAGCTCATGG - Intergenic
1097268325 12:57758698-57758720 AGTCAGGCCCCAGGAACTCACGG + Exonic
1097817886 12:64095611-64095633 AGGCACCCCCTAGGGTCACAGGG - Intronic
1097947591 12:65388985-65389007 AGCCATCCCTTAAGAGCTCATGG - Intronic
1099347892 12:81525476-81525498 AGGTAACCCCTAAGAGCTGAGGG + Intronic
1100671686 12:96820072-96820094 AGAGAGCCCTTAGGAGCTTATGG + Intronic
1101029579 12:100645997-100646019 AAGCACCCCCAAGGAGCCCACGG - Intergenic
1104462248 12:128965275-128965297 GGGCAGCCTCTAGGAGCTGGGGG + Intronic
1104943022 12:132403774-132403796 AGGCAGCCGCTGGCAACTCAAGG - Intergenic
1104944309 12:132408861-132408883 GGGCAGCCCCTCGGGGCTCCGGG - Intergenic
1108213596 13:48161848-48161870 AGGCTGCCTGTTGGAGCTCATGG - Intergenic
1108226154 13:48291875-48291897 AGGCAGCCTCTAGGAGCTGAGGG - Intergenic
1111389857 13:87578966-87578988 AGCCAGCCCCTAGGAACACGGGG + Intergenic
1113464488 13:110504013-110504035 GGGCAGCCCCGAGGGGCTCCAGG - Intronic
1113630573 13:111880347-111880369 AGGCAGGCACAGGGAGCTCAGGG - Intergenic
1116977179 14:51129350-51129372 AGGCAGCCTCTAGCGGCTGAGGG + Intergenic
1118702406 14:68446636-68446658 AGACAGCCACAAGGAGCTCCAGG - Intronic
1119114123 14:72002623-72002645 AGCCATCCCCAAGGAGCCCAGGG - Intronic
1119124958 14:72117076-72117098 AGGCAGCCCCTCAGAGATCTGGG + Intronic
1119322812 14:73741674-73741696 AGGCAGGCTCCAGGAGCACAGGG - Intronic
1120634187 14:86930895-86930917 GGGCAGCCCCTAGGAGCTGAGGG - Intergenic
1121161380 14:91744457-91744479 AGGCAGCTTCTAGGAGCTAAGGG + Intronic
1124238686 15:28012391-28012413 AGGCAGCCTCTGGGAGGTCTTGG + Intronic
1125731141 15:41893452-41893474 CTGCAGCCCCGAGGAGCTCCCGG + Exonic
1127129470 15:55847404-55847426 AGGCAACTCCTTGGAGTTCAAGG - Intronic
1127170151 15:56292692-56292714 AGGCAGCTCCTAGTGGCCCAAGG - Intronic
1127190956 15:56529991-56530013 GGGCAGCCTCTAGGAGCTGAGGG - Intergenic
1128081917 15:64861950-64861972 AGGAAGGCTCTAGGAGGTCAGGG + Intronic
1129193804 15:73952676-73952698 AGGCAGCACCTAGGGGTTCTGGG + Intergenic
1129465494 15:75722221-75722243 GGGCAGCCCTGAGGAGCTGAAGG + Intergenic
1129854234 15:78812194-78812216 AGGAAGCTCCTGGGAGCACAGGG - Intronic
1130243222 15:82217934-82217956 AGGTGGCCTCTAGGAGCTGAGGG + Intronic
1132142785 15:99408900-99408922 AGGCGGCAGCCAGGAGCTCAGGG - Intergenic
1132154362 15:99485374-99485396 AGGCAGCCCCTAGAGGCTGTGGG - Intergenic
1132359648 15:101201724-101201746 GGGCAGCCCCTACCAGCCCAGGG - Intronic
1132702863 16:1229488-1229510 GGGCAGCCCCCAGGAGCACCCGG + Intronic
1132705463 16:1241380-1241402 GGGCAGCCCCCAGGAGCACCCGG - Intronic
1132708591 16:1256743-1256765 GGGCAGCCCCCAGGAGCACCCGG - Intronic
1132722577 16:1323998-1324020 AGGCTGCACCTAGGGGCTGATGG - Intronic
1132835642 16:1951606-1951628 AGGCAGACCGTTTGAGCTCAGGG - Intronic
1133157142 16:3883146-3883168 AGGCAGGCCCTAAGACCTCTAGG - Intergenic
1133451233 16:5905609-5905631 AGGCTGAGCCTAGGAGGTCAAGG + Intergenic
1133805790 16:9125195-9125217 AGGCTGCACCTGGAAGCTCAGGG - Intergenic
1136147294 16:28322773-28322795 AGGCAGCCCCGATGGGCTCCAGG - Exonic
1136716294 16:32286431-32286453 AGGCAGACCCTGGGAGGGCAGGG - Intergenic
1136834680 16:33492709-33492731 AGGCAGACCCTGGGAGGGCAGGG - Intergenic
1137018077 16:35395313-35395335 ATGCAGCCCCAAGGCACTCATGG + Intergenic
1137597514 16:49734575-49734597 AGACAGCCCCCAGGAGGACAGGG - Intronic
1137690948 16:50427148-50427170 AGGTGACCTCTAGGAGCTCAAGG - Intergenic
1137720851 16:50626520-50626542 AGGCAGACGCCAGGGGCTCAGGG + Intronic
1137939626 16:52670868-52670890 GGGCAGACTCTAGGAGCTGAAGG + Intergenic
1140412139 16:74747684-74747706 TGGCAGCCCCCAGCAGCTCAGGG + Intronic
1140638352 16:76943052-76943074 AGGCAGCTTCTAGAAGCTGAGGG - Intergenic
1141088269 16:81112054-81112076 AGGGAGACCCTGGGAACTCAAGG - Intergenic
1141673141 16:85503303-85503325 AGGCAGCCCCCAGGAGGGAAGGG + Intergenic
1141807512 16:86351726-86351748 AGGCAGGCCCCAGGAGGGCAAGG - Intergenic
1141986360 16:87582810-87582832 AGGCAGCTCCTGCAAGCTCACGG - Intergenic
1142123718 16:88399927-88399949 AGGCAGACACCAGGAGCTCTGGG + Intergenic
1142212067 16:88813097-88813119 AGGCAGCCCCCAGGAGCCTTCGG + Intergenic
1203010123 16_KI270728v1_random:231323-231345 AGGCAGACCCTGGGAGGGCAGGG + Intergenic
1203144849 16_KI270728v1_random:1792997-1793019 AGGCAGACCCTGGGAGGGCAGGG - Intergenic
1143329130 17:6121011-6121033 AGCCAGCCTCCAGGAGCACACGG - Exonic
1143766842 17:9143355-9143377 AGGGATCCCCTGGGAGCTCACGG + Intronic
1144129357 17:12231007-12231029 TGGAAGCCCCTAGCAGCTCAGGG + Intergenic
1144356281 17:14449445-14449467 AGGCAGATCCCTGGAGCTCAGGG - Intergenic
1144478228 17:15607739-15607761 AGGGAGACCCTAGGGGCTCTGGG - Intronic
1144920066 17:18755967-18755989 AGGGAGACCCTAGGGGCTCTGGG + Intronic
1146211260 17:30945449-30945471 TGGCATCACCCAGGAGCTCAAGG + Intronic
1146547845 17:33754450-33754472 AGGAAGCCCCCAGGAGCTCAGGG - Intronic
1149552704 17:57551978-57552000 AGGCAACCCTTTGGAGCTGAGGG - Intronic
1150369373 17:64623243-64623265 AGGTAGACCTTAGGAGCTGAAGG - Intronic
1150444631 17:65219131-65219153 ATGCAGCTCCTAGGGACTCAGGG + Intronic
1151822146 17:76502141-76502163 AGGCAGGCCCTTGGAGTCCAGGG - Intergenic
1153985807 18:10350109-10350131 ATCCAGCCCCTAGGGTCTCAGGG + Intergenic
1157500249 18:48185428-48185450 AGGCAGCACCTGGAAGCTCTGGG - Intronic
1159955909 18:74518534-74518556 ACGCAGCCCCAATGAGTTCAAGG + Exonic
1160008807 18:75088570-75088592 CGGCTTCCCCCAGGAGCTCAGGG + Intergenic
1163289701 19:16371235-16371257 TGGCAGCACTTAGGACCTCAGGG + Intronic
1163324464 19:16594303-16594325 AGGCAGCCCCTGGTGGCTCTGGG + Intronic
1163604559 19:18266887-18266909 CTGCAGCCCCCAGCAGCTCAGGG - Exonic
1163636253 19:18438349-18438371 CCGCAGCCCCCAGGGGCTCATGG + Intergenic
1163643608 19:18475859-18475881 AGACGGCCCCTGTGAGCTCAAGG - Intronic
1164578311 19:29418915-29418937 AGGCAGCCCATGCCAGCTCAGGG + Intergenic
1164735575 19:30538663-30538685 AGGCAGCCTCCAGGATCTGATGG - Intronic
1165038905 19:33054968-33054990 AGGCAGACCCTCGGGGCTGATGG + Intronic
1165261466 19:34622777-34622799 AGGCAGCCCCTAATATCTGAAGG - Intronic
1167729866 19:51245887-51245909 AGACAGCCTCTAGCATCTCAAGG + Intergenic
1168073113 19:53963477-53963499 AGGCAGCCCCGGGAGGCTCAGGG - Intronic
1168078368 19:53992463-53992485 AAGCAGCCCCTTGGAGCTGCAGG + Exonic
926207693 2:10845830-10845852 AGGTGGCCCCTTGGAGCTCAAGG - Intergenic
927856563 2:26531170-26531192 AGGCAGCCTCTGTGAGCTCTGGG + Intronic
928866265 2:35920811-35920833 AGGCAGGCAATAGGAGCTGAGGG + Intergenic
929561029 2:42956582-42956604 AGGCACCCTCTAGGAGCTGATGG - Intergenic
930332387 2:50001989-50002011 AGGCAGCCTCTAAGAGTTGAGGG + Intronic
932139821 2:69265369-69265391 AGGCAGAAAGTAGGAGCTCAGGG + Intergenic
932307452 2:70714231-70714253 AGACAGCCCCCAGCAGCTCTGGG - Intronic
937374177 2:121323936-121323958 AGGCCGCCCCTAGGAGGTAAGGG + Intergenic
937978170 2:127593944-127593966 GGGCAGCACCCAGGAGCTCAGGG + Intronic
939262454 2:139828288-139828310 TTGCAGCCCCTAGATGCTCAAGG + Intergenic
943000590 2:182323713-182323735 AGGAAGCCCCCAGGAACACAAGG + Intronic
943682693 2:190784931-190784953 AAGCAGCCTCTAGGAGCTCAGGG + Intergenic
943693103 2:190889753-190889775 AGGCTGCCCCTGTCAGCTCATGG - Intronic
945219957 2:207473466-207473488 TGGCAGCCCCCAGGAGCTCAGGG - Intergenic
945841293 2:214890809-214890831 AGGCAGCCTCAGGGAGGTCAGGG + Intergenic
946159027 2:217824878-217824900 AGGCAGGCTCTGGGAGCCCACGG - Intronic
947968187 2:234299951-234299973 CGGCAGCCTCTAGGAGCTGAGGG - Intergenic
948641790 2:239379687-239379709 TGGCAGCCCCAAGGAGCCCCAGG + Intronic
948923919 2:241081935-241081957 GCGCAGCCCCTGGGGGCTCAGGG - Intronic
1168971147 20:1931693-1931715 AGGCTGCCACTTTGAGCTCAAGG + Intronic
1169304181 20:4474210-4474232 AGGCAGCTCCAAGCAGCTCAGGG - Intergenic
1169335513 20:4752680-4752702 AGGCTGAGCCTAGGAGTTCAAGG + Intergenic
1170080471 20:12469268-12469290 AGGAAGACCCGAGGAGCTCAGGG - Intergenic
1170976207 20:21166989-21167011 ATGCAGCCTCTAGGGGCTAAGGG + Intronic
1171460241 20:25294041-25294063 AGGATGGCCCTGGGAGCTCAAGG - Intronic
1172166584 20:32903250-32903272 AGTCAGCCCCGGGGAGCCCAGGG - Intronic
1172694784 20:36815168-36815190 AGAGAGCCCCTGGGAGCCCAAGG + Exonic
1172765824 20:37350189-37350211 AAGTGGCCCCCAGGAGCTCAAGG - Intronic
1172993981 20:39056423-39056445 ATGCTGCCCCTTGTAGCTCAAGG + Intergenic
1173659583 20:44724052-44724074 AGGCATGGCCTAGGTGCTCAGGG - Intronic
1173670960 20:44798643-44798665 AGGCAGCTCCTATGAGCTAAGGG - Intronic
1173860209 20:46278154-46278176 AGGGAGTGCCTAGGAGCCCAGGG - Intronic
1173893235 20:46529753-46529775 CAGCAGCCCCCAGGAGATCAAGG + Intergenic
1174105481 20:48159371-48159393 AGAGAGCCACTAGCAGCTCAGGG + Intergenic
1174127378 20:48316938-48316960 AGGAAGCCTCTAGCAGCTCTAGG + Intergenic
1175228471 20:57459246-57459268 AGTCAGCCCCTGGCAGCCCAGGG + Intergenic
1175604455 20:60300723-60300745 AGGGCACCCCTAAGAGCTCAGGG + Intergenic
1177194358 21:17886961-17886983 TGTCATCCCCTAGGACCTCAGGG - Intergenic
1179421612 21:41240925-41240947 AGGCATCCCCTGGGTGCCCATGG - Intronic
1179531259 21:42021148-42021170 AGGTGGCTGCTAGGAGCTCACGG + Intergenic
1179727545 21:43348771-43348793 AAACAGCCCCTCGGAGCTCATGG + Intergenic
1179890117 21:44331060-44331082 AGGCAACTCCTGGGAGGTCAGGG + Intronic
1179906776 21:44426779-44426801 AGGGAGCCCCTAGGAGGCCCTGG - Intronic
1180253448 21:46605600-46605622 AGGCAGCCCCGTTGAGCCCAGGG - Intergenic
1180701770 22:17785131-17785153 AGGCAGCCCCCTGCAGCTCGAGG - Intergenic
1180903927 22:19395184-19395206 AGCCAGCTCCTTGAAGCTCAAGG + Intronic
1181276095 22:21688335-21688357 AGGCAGACCCCAGGGGCCCAGGG - Intronic
1182618194 22:31602851-31602873 AGACAGGCACTTGGAGCTCATGG - Intronic
1182723728 22:32426109-32426131 AGCCAGCCCCGAGCAGCTCCAGG + Intronic
1183047175 22:35229433-35229455 AGGCAGCCCCTAGCAGATGCTGG - Intergenic
1183360546 22:37380864-37380886 AGGGAGCTCCAAGGAGCTCTAGG - Intronic
1184175935 22:42788706-42788728 AGGCAGCTCCTAGGAGCAACAGG + Intergenic
1184394345 22:44224011-44224033 AGGCATCCCCCAGGGTCTCAGGG - Intergenic
1184645662 22:45893312-45893334 AGCCAGCCCCTAGGAGGCCAGGG - Intergenic
1184665488 22:45986912-45986934 GGGAACCCCCTAGGGGCTCAGGG - Intergenic
1184913076 22:47549090-47549112 AGCAGGCCCCCAGGAGCTCAGGG - Intergenic
1184914459 22:47559503-47559525 GGGCTGCCCCTGGGAGCTCAGGG + Intergenic
1184928112 22:47658527-47658549 AGGCAGTCCCTAGCAACTCCAGG - Intergenic
1185199065 22:49491048-49491070 AGGCAGCGCATGGGAGCTCACGG + Intronic
950148516 3:10668563-10668585 AGGCAGCCCTTAGGATATCTGGG - Intronic
952616083 3:35276034-35276056 AAGAAGCCCCTGGGAGATCATGG + Intergenic
953638813 3:44686329-44686351 AGGCAGACAGTAGCAGCTCAGGG - Intergenic
953956791 3:47237693-47237715 AGGCAGCCCCCAGGTGCTAGAGG + Intronic
954155810 3:48684492-48684514 AGGAAGCCCCTAGGCCCCCAGGG + Intronic
955132600 3:56185978-56186000 AGGAAGCCTCTAAGGGCTCAGGG + Intronic
957314142 3:78556063-78556085 AGGCAGCCACTAGCAGCTGGAGG - Intergenic
958535154 3:95392148-95392170 AGGCAGCCCCTAAGCTTTCATGG + Intergenic
959137119 3:102437108-102437130 ACCCAGACCCTAGGAGCTCTTGG - Intronic
960626074 3:119683537-119683559 AGGAGGCCTCTAGGAGCTGAGGG - Intergenic
961097730 3:124172280-124172302 AGGAAGACCTTAGGAACTCACGG - Intronic
961476511 3:127150144-127150166 AGCCAGCCCTTAGGATCTCCAGG - Intergenic
967310690 3:188103435-188103457 GGGCAGTCCCTAGAAGCTCAAGG + Intergenic
968548999 4:1212917-1212939 AGGCAGCCCCATTGAGCTCAGGG + Exonic
968666784 4:1826770-1826792 AGCCAGCCCCCAGGAGGACAGGG - Intronic
969272809 4:6114328-6114350 GGGCAGCCCCAAAGAGGTCAAGG + Intronic
969465397 4:7353362-7353384 AGTCAGCTACTAGGAGCTCCTGG + Intronic
970435280 4:16027603-16027625 AGGGAGCCTCTGGGAGTTCAAGG - Intronic
971187495 4:24394310-24394332 AGCCAGCTCCTTGGATCTCATGG - Intergenic
976720827 4:88167267-88167289 AGGCAGCCAAGAGGAGCTGAGGG - Intronic
976767324 4:88610844-88610866 ATGCAGCTCCAAGGAGCTAATGG + Intronic
978782138 4:112567218-112567240 GGTCAGCTCCAAGGAGCTCAGGG - Intronic
979283901 4:118899071-118899093 AGGCTGCACGTGGGAGCTCAAGG - Intronic
979499622 4:121424826-121424848 AGGCAGCACTGAGGAGGTCAAGG + Intergenic
979728991 4:123998953-123998975 AAGCAGCCTCTAGGAGATGAAGG - Intergenic
979790833 4:124779431-124779453 AGGCATCCTCTAGGATCTGAGGG + Intergenic
981911953 4:149992275-149992297 AGGCAGCCTCTAGGATCTGAAGG + Intergenic
981998471 4:151000989-151001011 GGGGAGCCCCTAGGACCTCATGG + Intronic
982996722 4:162358069-162358091 CAGCAGCCACTAGAAGCTCAAGG - Intergenic
983297397 4:165883275-165883297 AGGCAGACCATGGCAGCTCATGG - Intronic
983420348 4:167508106-167508128 AGTCGGCCACTAGGAGCTCAGGG - Intergenic
984821215 4:183884339-183884361 AACCGGACCCTAGGAGCTCAAGG - Intronic
985381438 4:189399072-189399094 AGGCTGCCCCCAGGGCCTCAGGG - Intergenic
985517880 5:356407-356429 AGGCACCCCCAAGGAGTTCTGGG - Intronic
985704063 5:1390529-1390551 AGGCAGGCCCTGGGGGCTCCAGG + Intergenic
985719270 5:1480880-1480902 AAGCAGCCCCTACGTGTTCATGG + Intronic
986175388 5:5348061-5348083 AAGGGGCCTCTAGGAGCTCAGGG + Intergenic
986421979 5:7594355-7594377 AGGCAGCTCATAGGACCCCAAGG + Intronic
986480445 5:8181281-8181303 AGGAAGCACCTCGGAGCTCAAGG + Intergenic
988161284 5:27520803-27520825 AGGCAGCCTCTAGAAGGCCAAGG + Intergenic
989697871 5:44224896-44224918 AGGCAGCCCCAAGGATGCCATGG - Intergenic
989784647 5:45312882-45312904 ATGGAGCCCCTCGCAGCTCAAGG + Intronic
990173712 5:53083739-53083761 AGGCTGCCCCTTGTAGCCCAGGG - Intronic
990361233 5:55022099-55022121 AGCCAGCACATAGGAGCTTAAGG + Intronic
990449983 5:55924917-55924939 AGGCATCGCCTAGGAGCTGGAGG - Intergenic
990942308 5:61214995-61215017 AGACAGCCTCTAGGAGCTAAGGG - Intergenic
991114558 5:62939076-62939098 CGGGAGCCTCTAGGAGCTGAGGG - Intergenic
994026617 5:95091562-95091584 AGGCAGCCCCCAGGCAGTCAGGG - Intronic
994945528 5:106383143-106383165 AGACAGCCCCTAGTACCTCAAGG - Intergenic
995271662 5:110227299-110227321 AGGCAGCCACCAGGAGACCATGG + Intergenic
997144184 5:131414180-131414202 AGGAGGCCTCTAGGAGCTAAGGG - Intergenic
998418126 5:141960124-141960146 TAGGAGCCCCTGGGAGCTCAGGG + Intronic
999186939 5:149718213-149718235 TGGCAGCCCATAGAAGCCCATGG + Intergenic
999879326 5:155843799-155843821 AGGCAGCCACTGGGGGTTCAAGG - Intergenic
1001236613 5:170035139-170035161 AGCCAGCCCATGGGAGCTCATGG - Intronic
1002096675 5:176835281-176835303 AAGCAGGCCCTGGGGGCTCAGGG + Intronic
1002522351 5:179798758-179798780 AGGCAGCCCCTAGGAGCTCAGGG - Intronic
1003167160 6:3690547-3690569 AGGAAGCCCTTAGCAACTCAGGG - Intergenic
1004827466 6:19438726-19438748 GAGCAGCCACTAGGACCTCAGGG - Intergenic
1006221796 6:32497710-32497732 AGGCCTCCCATAGCAGCTCAAGG - Intergenic
1007964513 6:45991348-45991370 AGGCAGCCTCTAGGGGCTGAGGG + Intronic
1008150708 6:47948224-47948246 GGGTAGCCTCTAGGAGCTGAGGG - Intronic
1008259187 6:49343957-49343979 AGGCAGCTTCTAGGAGCTGAGGG - Intergenic
1011110875 6:83835551-83835573 AGGCAGCCCCTAGAACCTGAAGG - Intergenic
1012914439 6:105154544-105154566 CTGCAGCCCCTAGGAACTCATGG - Intergenic
1012922585 6:105234973-105234995 AAGAAGCCCCTGGGAGCTCGCGG + Intergenic
1014065451 6:117119302-117119324 AGTCAGTGCCTAGGTGCTCAAGG - Intergenic
1014255504 6:119157080-119157102 AGCCAGCCCCTTGGGGCTGAGGG + Intergenic
1014840196 6:126210315-126210337 AGGCAGCCTCCAGGAGCTGAGGG + Intergenic
1015721845 6:136250471-136250493 AGTCAGCCAATAGGAGCTGACGG + Intergenic
1015754402 6:136593020-136593042 AGGCAGCCCCAAGATGCTAATGG - Intronic
1016204131 6:141452554-141452576 AGGCAGAGAGTAGGAGCTCAGGG + Intergenic
1018052365 6:160022409-160022431 AGGCACCCCCTTAAAGCTCAGGG + Intronic
1018634282 6:165847178-165847200 AGCCACCTCCTAGGAGCTAAAGG - Intronic
1018644090 6:165931759-165931781 AGACAGCCCCTAGGAGAGCTGGG - Intronic
1019475962 7:1244344-1244366 AGGCAGCGGCTGGGTGCTCACGG - Intergenic
1019661394 7:2225990-2226012 GGGCAGCACCTAGGAGTTGATGG - Intronic
1021787708 7:24168979-24169001 AGGCAGCCTCCAGCAGCTGAAGG - Intergenic
1022479608 7:30734206-30734228 AGGAAGCCCCGAGGAGGTCAGGG - Intronic
1023352321 7:39333058-39333080 AAGCACCCCCTGGGAACTCATGG + Intronic
1024479671 7:49850928-49850950 TGGCAGCCCCAGGGAGCTAATGG - Intronic
1024535569 7:50428368-50428390 GGACAGCCTCTAGGAGCTGAGGG - Intergenic
1024562427 7:50655757-50655779 AGGCAGCGCCTAGGAAGCCAGGG - Intronic
1026893517 7:73996963-73996985 ACGCAGCCACCTGGAGCTCATGG + Intergenic
1028503166 7:91541310-91541332 AGGGAGCCTTCAGGAGCTCAGGG - Intergenic
1029225224 7:99022141-99022163 AGGCACTCACTAGGAGCTCTGGG + Intergenic
1029286361 7:99468659-99468681 AGGCAGCCTCCGGGAGCTGATGG + Intergenic
1030973434 7:116090363-116090385 AGGCCGAGCATAGGAGCTCAAGG - Intronic
1031408975 7:121420007-121420029 AGGCTCCTCCCAGGAGCTCAGGG - Intergenic
1031633815 7:124077729-124077751 AGGTAGCCACTAGGATGTCAGGG + Intergenic
1032969856 7:137148343-137148365 AGGCAGCTTCTAGGACCTGAGGG - Intergenic
1033022389 7:137739498-137739520 AGGAAGCCGCTAGGATCTCGAGG - Intronic
1036963939 8:13275894-13275916 AGACAGCCCCGAGGATCTCAGGG + Intronic
1037399045 8:18475161-18475183 AGGTGGCCTCTAGGAGCTGAGGG - Intergenic
1039049812 8:33483137-33483159 AGGCAGCCTCTAGGACCTGTGGG + Intronic
1039301568 8:36214861-36214883 AGGCAGCCTCTAGGAGATGAGGG - Intergenic
1039414679 8:37383689-37383711 AGGGAGCCACAAGGAGCCCAGGG + Intergenic
1039743142 8:40400180-40400202 AGGTAGCCCCAAGGAGCTTCTGG - Intergenic
1040294367 8:46141635-46141657 GGGCAGGCCGTAGGGGCTCACGG - Intergenic
1040384446 8:46904658-46904680 GTGCAGCCCCTAGGACCTCACGG - Intergenic
1040485165 8:47864240-47864262 TGGCAGCCCCTAGGACCGCCAGG + Intronic
1043126272 8:76399438-76399460 AGGGAGCCTCTATGAGCTTACGG + Intergenic
1045797295 8:106061158-106061180 AGGAAGCCCCTATGAGGCCATGG - Intergenic
1047969898 8:130075519-130075541 CGGAAGCTCCGAGGAGCTCAGGG - Intronic
1048415469 8:134223592-134223614 TGGCAGGCCCTAGTATCTCAGGG + Intergenic
1048983616 8:139716893-139716915 CAGCAGCCTCTAGGAGCTGAGGG + Intergenic
1049370002 8:142259855-142259877 AGGCATCCCCTAGGTGCCCCCGG - Intronic
1049569721 8:143363620-143363642 AGGTGGCCCCCAGGAGCTCAGGG - Intergenic
1056813489 9:89782511-89782533 AGGCAGCCCAGAGGGGCCCAGGG - Intergenic
1057180907 9:93029677-93029699 AGGCAGCCGCTGGGAGGTGAGGG + Intronic
1058156769 9:101524629-101524651 AGTAAGGCCCTGGGAGCTCACGG - Intronic
1058676884 9:107407703-107407725 AGGCAGCCCCTTCAAGCTCTGGG + Intergenic
1060208021 9:121693949-121693971 AGGCAGCCCCTAGGGAACCAGGG - Intronic
1061316500 9:129799585-129799607 AGGCAGCCTCTTGGTCCTCAGGG + Intergenic
1061970513 9:134042258-134042280 AGGCAGCCCCAGGGAGCTTTGGG - Intronic
1062038801 9:134394848-134394870 AGGGGGCCCCATGGAGCTCAAGG + Intronic
1062148107 9:135001920-135001942 TGGCAGCCCCAGGGAACTCATGG + Intergenic
1062287887 9:135781248-135781270 TGTCAGCCCAGAGGAGCTCACGG - Intronic
1186288833 X:8074393-8074415 AGGCAGCCACTAGGTTCTGAAGG - Intergenic
1187045133 X:15640348-15640370 AGGCAGAGACTAGCAGCTCAGGG - Intronic
1187260922 X:17684533-17684555 AGGTGGCCTCTAGGAGCTGAGGG - Intronic
1187965976 X:24612122-24612144 AGGTGGCCTCTAGGAGCTGAGGG + Intronic
1188257591 X:27981374-27981396 AGCCAACCCCTAAAAGCTCAGGG + Intergenic
1189244570 X:39553623-39553645 AGGCAGTCACTAGGAGAGCAGGG - Intergenic
1189591639 X:42518614-42518636 TGGAAGCCTCTAGGAGCTGAGGG - Intergenic
1190251361 X:48729005-48729027 ATGCACCCACTAGGAGCTCAGGG + Intergenic
1190392534 X:49946457-49946479 AGGCAGCCCCTAGGATCTGAGGG - Intronic
1190451288 X:50583654-50583676 AGGCAGCCACTAGGAGGTGAGGG + Intergenic
1190629916 X:52376486-52376508 TGGCAGTCCCTAGGAGCTCTAGG + Intergenic
1190871415 X:54427632-54427654 AGGCAGCCCCTAGGGTCTGAGGG + Intergenic
1191882890 X:65860122-65860144 ATCCAGCCCCGAGGAGATCATGG - Intergenic
1192522810 X:71816366-71816388 CAGCAGCCCCCAGGAGCCCAGGG + Intergenic
1192529043 X:71870692-71870714 CAGCAGCCCCTGGGAGCCCAGGG - Intergenic
1192588591 X:72340650-72340672 AGGAAGCACCTAGAAGCTGAAGG - Intronic
1193764784 X:85513921-85513943 AGTGAGCCCCTAGGAGTTAAAGG - Intergenic
1196055225 X:111348402-111348424 TGGCAGCCCCTCGATGCTCAAGG + Intronic
1196778982 X:119365441-119365463 AACCAGCCTCTAGGAGCTGAAGG - Intergenic