ID: 1002522352

View in Genome Browser
Species Human (GRCh38)
Location 5:179798759-179798781
Sequence CAGGCAGCCCCTAGGAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 1, 2: 6, 3: 51, 4: 310}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002522352_1002522357 11 Left 1002522352 5:179798759-179798781 CCTGAGCTCCTAGGGGCTGCCTG 0: 1
1: 1
2: 6
3: 51
4: 310
Right 1002522357 5:179798793-179798815 ACAAGGTAGCTACCATTACGAGG 0: 1
1: 0
2: 1
3: 3
4: 33
1002522352_1002522354 -6 Left 1002522352 5:179798759-179798781 CCTGAGCTCCTAGGGGCTGCCTG 0: 1
1: 1
2: 6
3: 51
4: 310
Right 1002522354 5:179798776-179798798 TGCCTGACTTAGTCCTCACAAGG 0: 1
1: 0
2: 1
3: 14
4: 165
1002522352_1002522359 27 Left 1002522352 5:179798759-179798781 CCTGAGCTCCTAGGGGCTGCCTG 0: 1
1: 1
2: 6
3: 51
4: 310
Right 1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG 0: 1
1: 0
2: 0
3: 6
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002522352 Original CRISPR CAGGCAGCCCCTAGGAGCTC AGG (reversed) Intronic
900089133 1:911742-911764 CAGGCAGCTCCTGGGTGCACGGG + Intergenic
900136661 1:1120515-1120537 CAGTCAGGGCCGAGGAGCTCAGG - Intergenic
900815595 1:4841387-4841409 CAGCCAGCTCCTAGGAGCTGAGG + Intergenic
901166863 1:7227670-7227692 CAGGCAGCCCCCAGGAACATTGG - Intronic
902988638 1:20171059-20171081 CAGCCAGCCCACAGGAGCCCAGG + Intronic
904590735 1:31614118-31614140 CAGGCAGCCGCTAGGAGAGGAGG - Intergenic
907700913 1:56787349-56787371 CAGGCATCCCCTGGGTGCTGGGG - Intronic
908510397 1:64846332-64846354 GAGTCAGGCCCAAGGAGCTCTGG - Intronic
910108875 1:83660598-83660620 CAGGCAGCCTCCAGGATCTTAGG - Intergenic
912344994 1:108955835-108955857 CCAGCAGCCCCTAGGTTCTCAGG + Intronic
912500492 1:110118847-110118869 CAAGCAGCCTCTAGGAACTGTGG - Intergenic
915731125 1:158055250-158055272 AAGTCAGGCTCTAGGAGCTCTGG - Intronic
916793174 1:168142046-168142068 CAGGCAGCCTCTGGGAGCAGAGG - Intergenic
918099033 1:181357550-181357572 CAGGCAGCCTCTGTGAGTTCAGG + Intergenic
918805129 1:189031020-189031042 CAAGCAGCCCCCATGAGCTTAGG + Intergenic
919301231 1:195769283-195769305 CAGGCAGCCCCTAGGAACCTGGG - Intergenic
920878411 1:209858701-209858723 CAAGCCTCCCCGAGGAGCTCCGG - Intergenic
922109576 1:222543896-222543918 CAGGCAGCCCTGAGGATCTTGGG + Exonic
922505898 1:226125427-226125449 CATCCATCTCCTAGGAGCTCAGG - Intergenic
922616548 1:226964444-226964466 CTGGCCGTCCCTAAGAGCTCAGG - Intronic
922959573 1:229635087-229635109 CAGGCAGCCCGAAGGAGCTGTGG + Exonic
923435662 1:233965566-233965588 CAGGCAGCCTCTAGGAGCTAAGG + Intronic
1062972931 10:1662277-1662299 CAGGCAGCCTCCAGGAGCCCAGG + Intronic
1066288617 10:33993020-33993042 CAGGGATCACCTAGGAGCTGAGG + Intergenic
1066302866 10:34112117-34112139 CAGGCAGTCCCTTAAAGCTCTGG + Intronic
1067693666 10:48520368-48520390 CAGGCAGCCCTCAGCAGCCCAGG + Intronic
1067832005 10:49615778-49615800 CAGGTGGCCCCTAGGGGCCCTGG + Intronic
1069663365 10:70138583-70138605 AGGGCAGCCCCCAGGAGCTGAGG - Exonic
1069753641 10:70760625-70760647 CACACAGCTCCCAGGAGCTCTGG + Exonic
1070724913 10:78781281-78781303 CAGGCAGCCGCTGAGAGGTCTGG - Intergenic
1070786885 10:79167058-79167080 GAGGCAGCCCATAGAAACTCAGG - Intronic
1071499537 10:86193578-86193600 GAGGCAGCCCCTTCCAGCTCAGG + Intronic
1072636221 10:97180128-97180150 CAGGCAGCCGCTGGGAACCCTGG - Intronic
1072810033 10:98454421-98454443 AAGGCAGCCCCTGTGAGCGCTGG - Intergenic
1073458221 10:103650482-103650504 CAGGCAGCCCCCAGGCACTGTGG + Intronic
1073723515 10:106202906-106202928 CAGGAAGCCTCTAGGACCTGCGG + Intergenic
1074404474 10:113169209-113169231 CAGGCAACCCTCAGGGGCTCCGG - Intergenic
1075282679 10:121154010-121154032 CAGGCAGCCTCTAGGACCTGAGG - Intergenic
1075723591 10:124600689-124600711 CAGGCAGGCCCCTGGGGCTCAGG - Intronic
1075778803 10:125004005-125004027 CAGGAGGCCTCTAGGGGCTCAGG + Intronic
1075840355 10:125496808-125496830 CATGCAGCCCCTAGTATTTCTGG + Intergenic
1076138676 10:128062910-128062932 CAGGCAGCCCCTACCGGTTCCGG + Intronic
1076336691 10:129711423-129711445 GAGGCAGCCCCGGGGACCTCCGG - Intronic
1076371704 10:129959663-129959685 CAGGGAGGCCCCGGGAGCTCGGG - Intronic
1076550206 10:131273184-131273206 CGGGCAGCCCCTGGGAGTCCAGG - Intronic
1077035645 11:493178-493200 CAGACAGCGCCCAGGGGCTCTGG + Intergenic
1077179193 11:1204592-1204614 CAGGCAGCAGCTCCGAGCTCTGG + Intergenic
1077378764 11:2218104-2218126 CAGACAGCCTCAGGGAGCTCTGG - Intergenic
1077499499 11:2902781-2902803 CCAGAAGCCCCTTGGAGCTCTGG + Intronic
1078048912 11:7945151-7945173 GAGGCATCCCCTAGCAGCTGAGG + Intergenic
1078762061 11:14259528-14259550 CAGGCAGCTGCTGGGAGCTGGGG - Exonic
1079163050 11:18012571-18012593 CAGGTGGCCCCACGGAGCTCTGG + Intronic
1081619176 11:44608858-44608880 AAGGCAGCCCCTGGGGGCTCCGG - Intronic
1081811111 11:45914560-45914582 CAGACAGCACCTAGGTGCCCAGG + Intronic
1081986054 11:47305371-47305393 GAGGCACCCGCTAGCAGCTCAGG + Intronic
1083333109 11:61908200-61908222 CAGGGAGTCCCCAGGAGCCCTGG - Exonic
1083820210 11:65166185-65166207 CAGGCAGCCCCTTGGGCCTCAGG + Intergenic
1083855947 11:65393171-65393193 AAGGCAGCCCCTTGGGCCTCTGG + Intronic
1084096771 11:66916500-66916522 CTGGCAGCTCCTAGGAACTCAGG - Intronic
1084723420 11:70924336-70924358 CACGCTGCTCCTAGGATCTCGGG + Intronic
1085694454 11:78692087-78692109 GAGGCAGCCACTTGGAGCCCAGG - Intronic
1086139295 11:83476776-83476798 CAGGCAGCCTCTTGGAGCTTCGG + Intronic
1091013180 11:132024932-132024954 CATGAAGCCACTAGGATCTCAGG - Intronic
1091283594 11:134396001-134396023 CAAGCAGCCCCCAGGAGCTGAGG - Intronic
1091398090 12:166201-166223 CAGGCAGGCCCATGGGGCTCTGG + Intronic
1091586738 12:1821179-1821201 CAGACAGCCCCAAGAAACTCGGG + Intronic
1091702552 12:2673689-2673711 GAGGCAGCCTCTAGGAGCAGAGG - Intronic
1093686686 12:22063865-22063887 CAGGCAGATCCCTGGAGCTCAGG + Intronic
1094581856 12:31740632-31740654 CAGGCAGCCTCTCAGAGCTGAGG - Intergenic
1095944652 12:47746954-47746976 CAGGGAGGCCCTTGGGGCTCTGG + Intronic
1096611655 12:52805927-52805949 CAGGCACCCCTGAGGAGCTGGGG + Intergenic
1096974567 12:55692795-55692817 CACGCAGCACCCCGGAGCTCTGG + Intronic
1100808910 12:98317845-98317867 CATGCAGCCCCAAAGAGCTCTGG - Intergenic
1101062156 12:100983596-100983618 CAGGCAGCCTCTAGAAGCTGAGG - Intronic
1102281839 12:111624664-111624686 CAGGCAGCCTCTAGAAGCTGGGG - Intergenic
1102529636 12:113536784-113536806 CAGGCATCCCCCTGGAGCTTGGG - Intergenic
1104462247 12:128965274-128965296 TGGGCAGCCTCTAGGAGCTGGGG + Intronic
1104944310 12:132408862-132408884 TGGGCAGCCCCTCGGGGCTCCGG - Intergenic
1106013672 13:25848098-25848120 CAGGTAGCGCCACGGAGCTCAGG - Intronic
1106189417 13:27438258-27438280 CAGGCAGATCGTTGGAGCTCAGG + Intronic
1106226936 13:27793050-27793072 CAGGCAGCGGGTAGGAGGTCTGG - Exonic
1108226155 13:48291876-48291898 CAGGCAGCCTCTAGGAGCTGAGG - Intergenic
1109212418 13:59548999-59549021 GAGGCACCCCCTAGCAGCTTGGG - Intergenic
1111389856 13:87578965-87578987 CAGCCAGCCCCTAGGAACACGGG + Intergenic
1113630574 13:111880348-111880370 CAGGCAGGCACAGGGAGCTCAGG - Intergenic
1116977178 14:51129349-51129371 CAGGCAGCCTCTAGCGGCTGAGG + Intergenic
1119124957 14:72117075-72117097 CAGGCAGCCCCTCAGAGATCTGG + Intronic
1119322813 14:73741675-73741697 CAGGCAGGCTCCAGGAGCACAGG - Intronic
1119750632 14:77075111-77075133 CATGCAGCCACTTGGAGCTGTGG + Intergenic
1120634188 14:86930896-86930918 CGGGCAGCCCCTAGGAGCTGAGG - Intergenic
1121161379 14:91744456-91744478 CAGGCAGCTTCTAGGAGCTAAGG + Intronic
1121626927 14:95392376-95392398 GAGGCAGCCCCTAGAATGTCAGG + Intergenic
1121671465 14:95713889-95713911 GGGGCAGCCCCTGGGAGCTTGGG - Intronic
1122229257 14:100297369-100297391 CAGGCAGCCCCTGGCAGGCCTGG - Intronic
1122250239 14:100433881-100433903 CAGCCATCTCCAAGGAGCTCTGG + Intronic
1122307710 14:100776313-100776335 CAAACAGCCCCTAAGAGCCCAGG - Intergenic
1122540684 14:102496219-102496241 CAGCCAGCCCCTCGGGGCTCGGG + Intronic
1122626636 14:103088392-103088414 CAGGCAGCACCTAGAGTCTCAGG - Intergenic
1122693591 14:103542585-103542607 CAGGCAGCTCCTAACACCTCAGG + Intergenic
1122823086 14:104356790-104356812 CAGGCAGCCCCGTGCAGCTTAGG + Intergenic
1123739806 15:23225860-23225882 CCGGCGGCCGCTAGGCGCTCTGG + Intergenic
1124291031 15:28454833-28454855 CCGGCGGCCGCTAGGCGCTCTGG + Intergenic
1124645789 15:31436826-31436848 CAGCCATCCTCTCGGAGCTCCGG + Intergenic
1125749447 15:42018821-42018843 GAGGCAGCCCCTTGAATCTCAGG + Intronic
1126796812 15:52266293-52266315 CAGGCTGTCCCTGGGACCTCAGG - Intronic
1127190957 15:56529992-56530014 AGGGCAGCCTCTAGGAGCTGAGG - Intergenic
1128527021 15:68419446-68419468 CAGGCAGACCCTTGGTGCTGAGG + Intronic
1129193803 15:73952675-73952697 GAGGCAGCACCTAGGGGTTCTGG + Intergenic
1130067245 15:80615060-80615082 GATGCAGCCCCTCGGAGCCCAGG + Intergenic
1130341460 15:83002654-83002676 AAGGCCACTCCTAGGAGCTCTGG - Intronic
1130752311 15:86725225-86725247 CAAGGAGCTCATAGGAGCTCTGG + Intronic
1131244283 15:90776765-90776787 CAGGCAGATCCTTTGAGCTCAGG - Intronic
1132142786 15:99408901-99408923 CAGGCGGCAGCCAGGAGCTCAGG - Intergenic
1132154363 15:99485375-99485397 CAGGCAGCCCCTAGAGGCTGTGG - Intergenic
1132697801 16:1209718-1209740 CAGGCATCCGCTAGGCTCTCAGG + Intronic
1132835643 16:1951607-1951629 CAGGCAGACCGTTTGAGCTCAGG - Intronic
1132968826 16:2674900-2674922 CAGGCAGCCCCTCTGCCCTCTGG + Intergenic
1133805791 16:9125196-9125218 CAGGCTGCACCTGGAAGCTCAGG - Intergenic
1134868515 16:17630526-17630548 CAGCTAGCACCTAAGAGCTCAGG - Intergenic
1135064908 16:19301243-19301265 CAGCCAGCCCCTGGGAGAACAGG + Intronic
1136707731 16:32202810-32202832 CTGGCGGCCGCTAGGCGCTCTGG - Intergenic
1136716295 16:32286432-32286454 CAGGCAGACCCTGGGAGGGCAGG - Intergenic
1136760177 16:32726601-32726623 CTGGCGGCCGCTAGGCGCTCTGG + Intergenic
1136807927 16:33143785-33143807 CTGGCGGCCGCTAGGCGCTCTGG - Intergenic
1136834681 16:33492710-33492732 CAGGCAGACCCTGGGAGGGCAGG - Intergenic
1137597515 16:49734576-49734598 CAGACAGCCCCCAGGAGGACAGG - Intronic
1137598933 16:49743286-49743308 CAGGCCTCCCCTGTGAGCTCTGG + Intronic
1137604808 16:49780353-49780375 AAGGCAGCCCCAGGGAGCCCAGG + Intronic
1137614037 16:49836445-49836467 CAGTCTGCCTCCAGGAGCTCTGG + Intronic
1137720850 16:50626519-50626541 CAGGCAGACGCCAGGGGCTCAGG + Intronic
1140274115 16:73493645-73493667 CAGGTTGACCCTAGGAGCTCAGG - Intergenic
1140412138 16:74747683-74747705 CTGGCAGCCCCCAGCAGCTCAGG + Intronic
1141770318 16:86085804-86085826 CAGCCACCCCCTAGGAGGTAAGG - Intergenic
1142123717 16:88399926-88399948 GAGGCAGACACCAGGAGCTCTGG + Intergenic
1142235036 16:88918137-88918159 CAGGAAGCCCCTGGGACCCCAGG + Intronic
1142309670 16:89305146-89305168 CAGGCAGCCCGGAGCAGCCCAGG - Intronic
1203010122 16_KI270728v1_random:231322-231344 CAGGCAGACCCTGGGAGGGCAGG + Intergenic
1203062332 16_KI270728v1_random:986923-986945 CTGGCGGCCGCTAGGCGCTCTGG + Intergenic
1203144850 16_KI270728v1_random:1792998-1793020 CAGGCAGACCCTGGGAGGGCAGG - Intergenic
1142572013 17:880918-880940 CAGTCAGCCCCTTGGAGCCCTGG - Intronic
1143017092 17:3896658-3896680 CAGGCAGGCCTTGGGAGCTGGGG + Exonic
1144129356 17:12231006-12231028 CTGGAAGCCCCTAGCAGCTCAGG + Intergenic
1144478229 17:15607740-15607762 CAGGGAGACCCTAGGGGCTCTGG - Intronic
1144767206 17:17739337-17739359 AAGCCAGCCCCCAGGAGCTGGGG + Intronic
1144920065 17:18755966-18755988 CAGGGAGACCCTAGGGGCTCTGG + Intronic
1145776668 17:27533742-27533764 CAGACAGCCCTTAGGATCTGTGG - Intronic
1145877522 17:28330912-28330934 CAGCCAGCCGCTATGACCTCCGG + Intronic
1146003953 17:29149121-29149143 GAGGCGTCCCCCAGGAGCTCCGG + Intronic
1146547846 17:33754451-33754473 CAGGAAGCCCCCAGGAGCTCAGG - Intronic
1148324871 17:46777359-46777381 CAGGGAGCCCCTTGGAGAGCTGG - Intronic
1149597219 17:57871409-57871431 CAGCCTGCCCCTGGGAGCCCAGG - Intronic
1150239988 17:63623047-63623069 CAGGCTGCCCCGCGGAGCACGGG - Intronic
1152245437 17:79182725-79182747 GAGGGAGGCCCCAGGAGCTCTGG - Intronic
1152463903 17:80455167-80455189 CAGGGAGCCCTCAGGACCTCAGG - Intergenic
1152467936 17:80476282-80476304 CCGGCGGCGCCGAGGAGCTCCGG - Exonic
1152772921 17:82181161-82181183 CAGGGATCCCCTAGAAGCTGTGG + Intronic
1152839974 17:82561208-82561230 CAGGCAGCACTCAGGTGCTCAGG - Intronic
1153950719 18:10055443-10055465 CAGGCAGCCGCGAGGAGCCGTGG - Intergenic
1153985806 18:10350108-10350130 CATCCAGCCCCTAGGGTCTCAGG + Intergenic
1155125081 18:22866295-22866317 CAGGCAGCTGCTAAGAGCTGAGG + Intronic
1156328323 18:36094716-36094738 CAGCCAACCCCTCGTAGCTCAGG + Intergenic
1157185857 18:45539565-45539587 CAGGCAACCCCATGGAGCCCAGG + Intronic
1157500250 18:48185429-48185451 CAGGCAGCACCTGGAAGCTCTGG - Intronic
1157621567 18:49020297-49020319 CCGGCATCCCCCAGCAGCTCTGG + Intergenic
1157755973 18:50218224-50218246 CAGGCAGCCTTTAGGATGTCTGG + Intergenic
1158503167 18:58021952-58021974 CAGGCAGCTCCTCACAGCTCAGG - Intergenic
1158571520 18:58600552-58600574 CAGACAGACCCTAGGAGCCGTGG - Intronic
1158768054 18:60479399-60479421 CAGGAAGCACCTAGGAATTCAGG + Intergenic
1160008806 18:75088569-75088591 CCGGCTTCCCCCAGGAGCTCAGG + Intergenic
1160566069 18:79787467-79787489 CGGGCACCCCTCAGGAGCTCAGG - Intergenic
1162796619 19:13090562-13090584 CAGGCAGCCCCCAGGCTCCCTGG + Intronic
1163017151 19:14463585-14463607 AAGGAAGCCCCTGGGAGCACAGG - Intronic
1163289700 19:16371234-16371256 CTGGCAGCACTTAGGACCTCAGG + Intronic
1163324463 19:16594302-16594324 TAGGCAGCCCCTGGTGGCTCTGG + Intronic
1163604560 19:18266888-18266910 CCTGCAGCCCCCAGCAGCTCAGG - Exonic
1164453791 19:28389985-28390007 CAGGCAGATCCTTTGAGCTCAGG - Intergenic
1164578310 19:29418914-29418936 CAGGCAGCCCATGCCAGCTCAGG + Intergenic
1165150089 19:33755089-33755111 CATGCACCCCCCAGGGGCTCAGG + Intronic
1165362052 19:35342722-35342744 CAGGGACCCAGTAGGAGCTCAGG - Intronic
1168009475 19:53519188-53519210 CAGGGAGCCTCCTGGAGCTCAGG - Intergenic
1168073114 19:53963478-53963500 CAGGCAGCCCCGGGAGGCTCAGG - Intronic
1168650394 19:58088712-58088734 CAGCCAGGCCCTTGGAGCTGGGG - Exonic
1168720170 19:58550508-58550530 CAGACAGCTCCTGGGAACTCAGG - Exonic
925631241 2:5895490-5895512 CCAGCAGCTCCTGGGAGCTCAGG + Intergenic
926133495 2:10320143-10320165 CAGCCAGGCCACAGGAGCTCAGG - Intronic
927640834 2:24844358-24844380 CAGCCAGGCCCTAGGTGCTGAGG - Intronic
927856562 2:26531169-26531191 GAGGCAGCCTCTGTGAGCTCTGG + Intronic
930253415 2:49061117-49061139 GAGGCACCCCCTAGCAGCTTGGG - Intronic
930332386 2:50001988-50002010 CAGGCAGCCTCTAAGAGTTGAGG + Intronic
931899383 2:66770779-66770801 AAGGTAGCCTCTAGGAGCTGAGG + Intergenic
932307453 2:70714232-70714254 GAGACAGCCCCCAGCAGCTCTGG - Intronic
932718492 2:74120611-74120633 GCGGCGGCCACTAGGAGCTCAGG + Intergenic
934717304 2:96551422-96551444 CAGTCAGCCCTTTGGGGCTCTGG - Exonic
934859225 2:97749864-97749886 CAGGCAGTGGCAAGGAGCTCAGG + Intergenic
935386880 2:102509217-102509239 CAGGCAGCCTCTGGAAGCTGTGG - Intronic
936069186 2:109353949-109353971 GAGGAAGCCCCTAGATGCTCTGG + Intronic
937243015 2:120474611-120474633 CAGGGAGCCTCACGGAGCTCGGG + Intergenic
937374176 2:121323935-121323957 AAGGCCGCCCCTAGGAGGTAAGG + Intergenic
937665583 2:124483316-124483338 CAGGGAGCCACTAGGAGCTTGGG + Intronic
937978169 2:127593943-127593965 AGGGCAGCACCCAGGAGCTCAGG + Intronic
939439068 2:142219594-142219616 GAAGCAGCCCCTAGGAGGACAGG - Intergenic
942182698 2:173395659-173395681 CAGGCAGCCCCCAGAATCACAGG + Intergenic
943682692 2:190784930-190784952 GAAGCAGCCTCTAGGAGCTCAGG + Intergenic
944855812 2:203765483-203765505 TATGCAGGCCCTGGGAGCTCAGG - Intergenic
945103711 2:206288697-206288719 TAGGCACCCCCTAGTAGCTGGGG + Intronic
945219958 2:207473467-207473489 TTGGCAGCCCCCAGGAGCTCAGG - Intergenic
945476110 2:210284792-210284814 CAGGAACCCCCTAGCAGCTTGGG + Intergenic
947968188 2:234299952-234299974 ACGGCAGCCTCTAGGAGCTGAGG - Intergenic
1169189588 20:3649675-3649697 CTGGCAGCCTCTTGGTGCTCTGG + Exonic
1169304182 20:4474211-4474233 CAGGCAGCTCCAAGCAGCTCAGG - Intergenic
1170080472 20:12469269-12469291 CAGGAAGACCCGAGGAGCTCAGG - Intergenic
1170462995 20:16596744-16596766 CAGACAGCTCCTGGGAACTCAGG - Intergenic
1170814994 20:19706359-19706381 TAGGCAGCCCTTAGGAGAGCAGG - Intronic
1170976206 20:21166988-21167010 CATGCAGCCTCTAGGGGCTAAGG + Intronic
1171480978 20:25455402-25455424 CAGGCATCCCCAAGCACCTCTGG - Intronic
1172729989 20:37078968-37078990 CAGGCAGACCCTTGGAGCTCAGG + Intronic
1172969137 20:38860904-38860926 CAGGGGGCCCCTGGGAGCACTGG - Intronic
1173541250 20:43853205-43853227 CAGGCAGATCCTTTGAGCTCAGG + Intergenic
1173670961 20:44798644-44798666 AAGGCAGCTCCTATGAGCTAAGG - Intronic
1174105480 20:48159370-48159392 CAGAGAGCCACTAGCAGCTCAGG + Intergenic
1174576999 20:51543541-51543563 CACCCAGCCCCTTCGAGCTCTGG - Intronic
1175228470 20:57459245-57459267 CAGTCAGCCCCTGGCAGCCCAGG + Intergenic
1175783284 20:61696993-61697015 CTTCCAGCCCCTGGGAGCTCCGG - Intronic
1175906206 20:62380844-62380866 CAGCCAGCCCCCAGGAGGTGTGG + Intergenic
1175969205 20:62675389-62675411 CAGGCAGCTCCCAAGAGCTGCGG + Intronic
1175986237 20:62765421-62765443 CAGGCATCACCTAGGAGCCCTGG + Intergenic
1176360719 21:5995001-5995023 GAGGCACCCTCTAGCAGCTCGGG + Intergenic
1176884513 21:14238771-14238793 CAGGCAGCTGCTAGGCTCTCTGG - Intergenic
1177194359 21:17886962-17886984 CTGTCATCCCCTAGGACCTCAGG - Intergenic
1178661193 21:34509289-34509311 AGGGCAGCCTCTAGGAGCTGAGG - Intergenic
1178671566 21:34595803-34595825 CAGGCTGCCTCAAGGAGCTGGGG + Intronic
1178683728 21:34695180-34695202 CAAGCAGCCTCTAGAAGCTGGGG - Intronic
1179167111 21:38943967-38943989 CAGAGAGTCCCCAGGAGCTCGGG + Intergenic
1179462808 21:41549054-41549076 CACCCAGCCCCATGGAGCTCGGG + Intergenic
1179762799 21:43543549-43543571 GAGGCACCCTCTAGCAGCTCGGG - Intronic
1180118199 21:45725925-45725947 CAGGCCCCCTCTAGGAGGTCAGG + Intronic
1181341829 22:22187134-22187156 GAGGCATCCCCAAGGAGCCCGGG - Intergenic
1182881759 22:33739691-33739713 CAGGCTGCCCCACTGAGCTCAGG - Intronic
1184401736 22:44278563-44278585 CAGGCCGCCCCTGGGGGCTGCGG - Intronic
1184502561 22:44882806-44882828 CAGGCAGCCCCGAGGTGGCCGGG + Exonic
1184645663 22:45893313-45893335 CAGCCAGCCCCTAGGAGGCCAGG - Intergenic
1184913077 22:47549091-47549113 CAGCAGGCCCCCAGGAGCTCAGG - Intergenic
1184914458 22:47559502-47559524 GGGGCTGCCCCTGGGAGCTCAGG + Intergenic
1185020391 22:48371175-48371197 CACCCAGCCCCTGGGAGCCCAGG - Intergenic
1185232308 22:49690135-49690157 CAGGGAGCCGCTAGGAGCCCAGG + Intergenic
1185253055 22:49815797-49815819 CAGCCAGTGCCTGGGAGCTCGGG - Intronic
950148517 3:10668564-10668586 GAGGCAGCCCTTAGGATATCTGG - Intronic
952077310 3:29712819-29712841 CAGGCACCCACTAGGTTCTCAGG + Intronic
952885093 3:38007173-38007195 CAGGCAGCCCATACGAGCTGTGG + Exonic
955132599 3:56185977-56185999 CAGGAAGCCTCTAAGGGCTCAGG + Intronic
956084892 3:65598165-65598187 CCGGCAGCCTCTAGGAGCCCGGG - Intronic
956736712 3:72244097-72244119 CAGGCAGCCTCTAGGTGCTGGGG - Intergenic
956738581 3:72257871-72257893 CAGCCAGCCCTTAGCAGCCCCGG + Intergenic
957913275 3:86650989-86651011 CAGGCAGCCCCCAGAATCACAGG - Intergenic
960626075 3:119683538-119683560 CAGGAGGCCTCTAGGAGCTGAGG - Intergenic
961907301 3:130276275-130276297 CATTCAGCCCGTAGGAGCTTAGG + Intergenic
964661407 3:159124150-159124172 CAGTCAGCCACTAGGTGCTCTGG + Intronic
964705111 3:159609964-159609986 CAGGCAGCCCCTCGTAGCATAGG - Intronic
965911456 3:173782618-173782640 CGGGCAGCCCCCAGGAGAGCAGG + Intronic
966835042 3:184043043-184043065 CAGGCAGATCCTTTGAGCTCAGG + Intergenic
967963381 3:194942409-194942431 CAGCCAGGGCCTGGGAGCTCTGG + Intergenic
968548998 4:1212916-1212938 TAGGCAGCCCCATTGAGCTCAGG + Exonic
968666785 4:1826771-1826793 CAGCCAGCCCCCAGGAGGACAGG - Intronic
969280220 4:6165952-6165974 CCGGCAGCCCTCAGGAGCTGGGG - Intronic
970302697 4:14698134-14698156 CAGGCAGCCCCTAGGAGCTGAGG + Intergenic
972556953 4:40191137-40191159 CAGTCATTCCCTAGGAGCTCGGG + Intronic
972826870 4:42768551-42768573 CAGGCAGCCCCTAGGGGAGGGGG + Intergenic
974199865 4:58623563-58623585 CAGGGGGTCCCTAGAAGCTCAGG - Intergenic
975266234 4:72371087-72371109 CAGGCAACCACCAGGAGCTAGGG + Intronic
976720828 4:88167268-88167290 CAGGCAGCCAAGAGGAGCTGAGG - Intronic
978698745 4:111616639-111616661 GAGGCAGTCCCTATGACCTCTGG + Intergenic
979050177 4:115920806-115920828 TATGCAGACCCTAGGGGCTCTGG + Intergenic
980845578 4:138320390-138320412 CAGATGGCCCCTAGTAGCTCTGG - Intergenic
981625354 4:146748267-146748289 AAGGCATACCCTAGAAGCTCAGG - Intronic
981741278 4:148004610-148004632 CAGGCATCCTCTAGGAGCTGAGG + Intronic
983420349 4:167508107-167508129 CAGTCGGCCACTAGGAGCTCAGG - Intergenic
983588008 4:169376180-169376202 AAGGCACTCCCTAGGAGCTTGGG - Intergenic
983792414 4:171813824-171813846 CAGGCAGCGGCTGGGAGCCCCGG - Exonic
985121888 4:186651763-186651785 CACCCAGCCCCTCAGAGCTCTGG + Intronic
985381439 4:189399073-189399095 CAGGCTGCCCCCAGGGCCTCAGG - Intergenic
985517881 5:356408-356430 CAGGCACCCCCAAGGAGTTCTGG - Intronic
986311545 5:6554403-6554425 CCGGCTGCCCCTAGGAGATCTGG - Intergenic
987152326 5:15055891-15055913 GAGCCACCCCCTAGCAGCTCAGG + Intergenic
987751132 5:22039334-22039356 GAGGCACCCCCTAGTAGCTTAGG - Intronic
988645422 5:33090149-33090171 CAGACAGCTCCTGGGAACTCAGG + Intergenic
989698324 5:44231451-44231473 CAGGCAACCCCTATGCTCTCAGG - Intergenic
990173713 5:53083740-53083762 CAGGCTGCCCCTTGTAGCCCAGG - Intronic
990281014 5:54250726-54250748 CAGGCTGCCCCCAGGACCTGTGG - Intronic
990559367 5:56968150-56968172 CAAGCAGCCCCCAGGTTCTCAGG + Intronic
990735070 5:58851366-58851388 CAGGCAGCTCCAGGGGGCTCTGG + Exonic
990942309 5:61214996-61215018 AAGACAGCCTCTAGGAGCTAAGG - Intergenic
993559596 5:89389140-89389162 CAGGTAGCCTGTAGGAACTCTGG + Intergenic
993874565 5:93291590-93291612 CAGGCAGCCCACAGAAGCCCAGG + Intergenic
997144185 5:131414181-131414203 CAGGAGGCCTCTAGGAGCTAAGG - Intergenic
997362387 5:133303392-133303414 CAGGCAGGCAGTAGTAGCTCAGG + Intronic
998418125 5:141960123-141960145 CTAGGAGCCCCTGGGAGCTCAGG + Intronic
999142567 5:149372078-149372100 CTGGGAGACCCTAGGTGCTCTGG - Intronic
1002297385 5:178239161-178239183 CAGGCAGCCCGTCGGGGCCCTGG + Exonic
1002470229 5:179430564-179430586 AAGGCTGCCCCGTGGAGCTCTGG + Intergenic
1002522352 5:179798759-179798781 CAGGCAGCCCCTAGGAGCTCAGG - Intronic
1002928144 6:1616862-1616884 CAGGCAGGCCCAAGGAGCAGGGG - Intergenic
1007219613 6:40268297-40268319 CATCCAGTCCCTAGGAGGTCTGG - Intergenic
1007474377 6:42108944-42108966 CAGGCAGGACTTAGGAGCTGGGG + Intronic
1007597199 6:43058740-43058762 CAGTCACCCACTAGGACCTCAGG + Intronic
1007964512 6:45991347-45991369 TAGGCAGCCTCTAGGGGCTGAGG + Intronic
1008259188 6:49343958-49343980 AAGGCAGCTTCTAGGAGCTGAGG - Intergenic
1009411867 6:63374741-63374763 CAAGCAGCCTCTAGAAGCTGGGG - Intergenic
1011816733 6:91200127-91200149 CAGGTAGCCCCTAGAAACTGGGG + Intergenic
1012214914 6:96571625-96571647 GAGGGACCCCCTAGCAGCTCAGG + Intronic
1013289478 6:108708187-108708209 CAGACAGCCCTCAGGGGCTCTGG + Intergenic
1013811462 6:114049391-114049413 CAGGCAGATCACAGGAGCTCAGG - Intergenic
1014818150 6:125957215-125957237 CTGGCCGCCCCTCGGAGCTCCGG + Intronic
1014840195 6:126210314-126210336 CAGGCAGCCTCCAGGAGCTGAGG + Intergenic
1018644091 6:165931760-165931782 GAGACAGCCCCTAGGAGAGCTGG - Intronic
1019620636 7:1990239-1990261 CAGTCAGCCCCAGGGAGCCCTGG - Intronic
1022351059 7:29566305-29566327 CCGGGAGCCCCTAGGCCCTCCGG + Exonic
1022479609 7:30734207-30734229 GAGGAAGCCCCGAGGAGGTCAGG - Intronic
1023323701 7:39029047-39029069 CAGGCAGACCCTTTGAGCCCAGG - Intronic
1024597211 7:50948034-50948056 GAGGCACTCCCTAGCAGCTCAGG - Intergenic
1024750155 7:52455696-52455718 CAGGCAGCCACTCCGTGCTCAGG + Intergenic
1025149429 7:56537383-56537405 CAGGACGCCCCTTGGACCTCGGG - Intergenic
1028440254 7:90851482-90851504 CAGGCAGCTCCTGAGAGCTATGG - Intronic
1028503167 7:91541311-91541333 CAGGGAGCCTTCAGGAGCTCAGG - Intergenic
1029225223 7:99022140-99022162 TAGGCACTCACTAGGAGCTCTGG + Intergenic
1034344488 7:150378299-150378321 GAGGCAGCTTCTAGCAGCTCCGG + Intronic
1035738986 8:1911826-1911848 CAGGCAGCCCCATGGAGATGTGG - Intronic
1036963938 8:13275893-13275915 GAGACAGCCCCGAGGATCTCAGG + Intronic
1037399046 8:18475162-18475184 CAGGTGGCCTCTAGGAGCTGAGG - Intergenic
1038425319 8:27460813-27460835 CAGCCGGCCCCCAGGAGGTCTGG - Exonic
1039049811 8:33483136-33483158 CAGGCAGCCTCTAGGACCTGTGG + Intronic
1039301569 8:36214862-36214884 CAGGCAGCCTCTAGGAGATGAGG - Intergenic
1041079309 8:54201773-54201795 ATGGCACCCCCTAGTAGCTCAGG + Intergenic
1041123742 8:54613332-54613354 CAGGCAGGCCCAAGGAACCCAGG - Intergenic
1044524484 8:93236791-93236813 CAGGCAGCTTCTAGGGGCTTAGG - Intergenic
1045615309 8:103902203-103902225 CAGGCAGCCTTTAGGAACTGTGG - Intronic
1045650853 8:104340651-104340673 CAGCTAGCCCATAGGAGCTGAGG + Intronic
1045704874 8:104910861-104910883 CAGGTAGCCTCTAGGACCTGTGG + Intronic
1047564704 8:126031244-126031266 CAGGTTGCCCCTAGGAGAGCTGG - Intergenic
1047778475 8:128092547-128092569 CAGGCAGCCCCTACCGGTTCCGG - Intergenic
1049005097 8:139849983-139850005 CAGAGAGCCCCTGGGAGGTCTGG - Intronic
1049486491 8:142866441-142866463 CAGGCAGCTCCCTGGAGGTCTGG + Intronic
1049505012 8:142991478-142991500 CTGACAGCCCCCAGGAGCTGAGG + Intergenic
1049526793 8:143130925-143130947 CAGGCAGCGCCTGGCAGGTCCGG - Intergenic
1049569722 8:143363621-143363643 CAGGTGGCCCCCAGGAGCTCAGG - Intergenic
1049792689 8:144479234-144479256 CAGGCAGCCCCCAGCCCCTCAGG - Intronic
1052202631 9:25801421-25801443 CAGGCAGATCGTTGGAGCTCAGG - Intergenic
1053424918 9:38004359-38004381 CACGCAGCCCCCAGCAGCTCAGG - Intronic
1055859350 9:80730095-80730117 CAGGCACCCCCTAGCAGCTTTGG + Intergenic
1057180906 9:93029676-93029698 CAGGCAGCCGCTGGGAGGTGAGG + Intronic
1057701714 9:97367699-97367721 CAGGCAGACCATTGGAGGTCAGG - Intronic
1057889691 9:98860014-98860036 CAGGTGGCCTCTAGGAGCTGAGG - Intergenic
1058676883 9:107407702-107407724 AAGGCAGCCCCTTCAAGCTCTGG + Intergenic
1058788515 9:108416790-108416812 AAGGCAGCTCCTAGGAGGCCAGG - Intergenic
1059484589 9:114617047-114617069 GAGACAGCCCCTAGGAACCCCGG + Intronic
1060112637 9:120917661-120917683 CAGGCAGCCCTGAGAAGCTGGGG - Intronic
1060838133 9:126773245-126773267 CAGACAGACCCTGGGAGCGCGGG + Intergenic
1061589385 9:131588814-131588836 CAGCCAGCCCCTGGCAGCCCGGG - Exonic
1061970514 9:134042259-134042281 GAGGCAGCCCCAGGGAGCTTTGG - Intronic
1062634770 9:137484966-137484988 CAGGCAGCCCCTGAGGGCTGGGG - Intronic
1187260923 X:17684534-17684556 CAGGTGGCCTCTAGGAGCTGAGG - Intronic
1187965975 X:24612121-24612143 CAGGTGGCCTCTAGGAGCTGAGG + Intronic
1189179790 X:38992842-38992864 CAGTCAGCCCCATGGAGCCCTGG + Intergenic
1190251360 X:48729004-48729026 CATGCACCCACTAGGAGCTCAGG + Intergenic
1190392535 X:49946458-49946480 CAGGCAGCCCCTAGGATCTGAGG - Intronic
1190451287 X:50583653-50583675 CAGGCAGCCACTAGGAGGTGAGG + Intergenic
1190871414 X:54427631-54427653 TAGGCAGCCCCTAGGGTCTGAGG + Intergenic
1193731254 X:85106748-85106770 CAGACAGCCCCCAGGAGCCAAGG - Intronic
1194131554 X:90088402-90088424 CAGGCAGCCACATGAAGCTCTGG + Intergenic
1200006250 X:153086823-153086845 CAGGCTGGCCCTAGGAGTACAGG - Intergenic