ID: 1002522353

View in Genome Browser
Species Human (GRCh38)
Location 5:179798767-179798789
Sequence GACTAAGTCAGGCAGCCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002522353_1002522359 19 Left 1002522353 5:179798767-179798789 CCTAGGGGCTGCCTGACTTAGTC 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1002522353_1002522357 3 Left 1002522353 5:179798767-179798789 CCTAGGGGCTGCCTGACTTAGTC 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1002522357 5:179798793-179798815 ACAAGGTAGCTACCATTACGAGG 0: 1
1: 0
2: 1
3: 3
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002522353 Original CRISPR GACTAAGTCAGGCAGCCCCT AGG (reversed) Intronic
900552968 1:3265667-3265689 GACAAACCCAGGCAGCCCCGGGG - Intronic
901632281 1:10653705-10653727 GATTGAGCCAGGCAGGCCCTGGG + Exonic
901640681 1:10691545-10691567 GACTATGTCAGAGAGGCCCTCGG + Intronic
903809782 1:26028838-26028860 GTCTAAGTCAGGCAGGGCCTCGG + Intronic
904169394 1:28581138-28581160 GACTAAGTCAGTCATCCTGTAGG + Intergenic
904173917 1:28611849-28611871 TACTAAGTCAGGCAGTGGCTGGG - Intronic
913244957 1:116863209-116863231 GACCAAGGCAGGCAACCCCGTGG - Intergenic
914332215 1:146682900-146682922 GACTAAGTCACGATGCCACTAGG - Intergenic
917025216 1:170634398-170634420 GACTAAGGCATGCAGGCCCTGGG + Intergenic
917629166 1:176876301-176876323 CATTAAGTCAGGGAGCCCATAGG - Intronic
919301233 1:195769291-195769313 GCAAAATTCAGGCAGCCCCTAGG - Intergenic
921682619 1:218052371-218052393 GACAAAGTCAGGCATCACGTAGG + Intergenic
921936195 1:220799376-220799398 GTCTAAGTCAGGCTGGCCCATGG - Intronic
922845641 1:228681953-228681975 GACCAAGGCAGGCATCCCCGTGG + Intergenic
923092329 1:230750092-230750114 TACTAAGGAAGACAGCCCCTTGG - Intronic
1063662685 10:8044953-8044975 GACCAAGACAGGCTCCCCCTGGG + Intergenic
1064032436 10:11891397-11891419 GACTGTGTCAGGCTGTCCCTTGG + Intergenic
1067747084 10:48944004-48944026 GAGTAAGCCAGGAAGCCCCCTGG - Intronic
1067832002 10:49615770-49615792 GACTAAGGCAGGTGGCCCCTAGG + Intronic
1069643458 10:69972558-69972580 GACTAAGTCAGTTAACCTCTTGG + Intergenic
1071567714 10:86680307-86680329 GGGGAAGTGAGGCAGCCCCTTGG + Intronic
1071821488 10:89285536-89285558 GACCAAGGCAGGCATCCCCACGG - Intronic
1072732233 10:97853940-97853962 GACTAAGTAAGGCACACCCATGG - Intronic
1073013694 10:100381703-100381725 GACCAAGGCAGGCATCCCCGTGG - Intergenic
1074190393 10:111130446-111130468 GACTAATTCAGTCAGCCTCATGG + Intergenic
1074302610 10:112246479-112246501 GGCTAAGTCAGGCAGATCATGGG - Intergenic
1076180180 10:128401232-128401254 CACTGAGCCAGGCAGCCCCATGG + Intergenic
1079349922 11:19683737-19683759 GAGCAAGTCATTCAGCCCCTGGG + Intronic
1080777733 11:35401913-35401935 GCCTAGGACAGGCAGCCACTAGG - Intronic
1084600492 11:70142645-70142667 GACTAAGACACCCACCCCCTGGG - Intronic
1086139294 11:83476768-83476790 TAATAAGGCAGGCAGCCTCTTGG + Intronic
1087132350 11:94679161-94679183 GACAGATTCAGGCAGCCCCCAGG + Intergenic
1094405976 12:30116593-30116615 GATGAAGTCAGGGAGGCCCTGGG - Intergenic
1095371634 12:41474479-41474501 GAGCAAGTCAGGAAACCCCTGGG - Intronic
1096157160 12:49347085-49347107 GGCTAAGTCATGCAGCTTCTTGG - Exonic
1098426209 12:70367217-70367239 GACTACATCAGGGAGCCCCAGGG + Intronic
1100452724 12:94722876-94722898 CACTAGGTCAGTCAGTCCCTTGG + Intergenic
1106284634 13:28308124-28308146 CACTGAGTCAGGCTGCACCTTGG - Intronic
1107392025 13:39975670-39975692 GACTCATTCAGGCAGCCAATGGG + Intergenic
1108282225 13:48871629-48871651 GACCAAGGCAGGCATCCCCGTGG + Intergenic
1108677390 13:52749008-52749030 GACTAAGTCAGTTACCTCCTTGG + Intergenic
1108846236 13:54680524-54680546 GAGAACGGCAGGCAGCCCCTAGG + Intergenic
1109561737 13:64058461-64058483 GTCTAGGCCAGGCAGTCCCTGGG + Intergenic
1111622699 13:90744861-90744883 GATTTAGTCAGGCAGACACTTGG - Intergenic
1113814321 13:113161134-113161156 GACCAGGTCAGGAAGCCCCCGGG + Intronic
1115091425 14:29581496-29581518 GTCAAAGTCAGACAGCTCCTAGG + Intronic
1118683658 14:68269330-68269352 GGCTGAGTCAGGCAGTGCCTTGG - Intronic
1119174229 14:72557448-72557470 GATGAAGTCAGGCAGGCCTTTGG + Intronic
1121193483 14:92049334-92049356 GACCAAGACAGGCACCCCCACGG + Exonic
1125828637 15:42695600-42695622 GGCTAAGTCAGGGAGGCCCTGGG + Intronic
1131592993 15:93769296-93769318 TACTAAGACAGGCAGCCCAGGGG + Intergenic
1135562475 16:23487325-23487347 GACTTAGCCAGACATCCCCTGGG - Intronic
1135869167 16:26133405-26133427 GGCTAAGGAATGCAGCCCCTGGG - Intronic
1137671815 16:50283696-50283718 GAGTAAGTAAGGGACCCCCTGGG + Intronic
1138510943 16:57508146-57508168 GACTCTACCAGGCAGCCCCTAGG - Intergenic
1139356444 16:66369596-66369618 GACAAAGTCAGGAAGCCCAGAGG + Intronic
1139364660 16:66426412-66426434 GCCTGAGCCAGGCATCCCCTCGG + Intergenic
1140001337 16:71028018-71028040 GACTAAGTCACGATGCCACTAGG + Intronic
1141627293 16:85268036-85268058 GACAAAGCCTGGCAGCCTCTGGG - Intergenic
1141660367 16:85438086-85438108 GAGAAAGGTAGGCAGCCCCTGGG - Intergenic
1146169297 17:30620964-30620986 GACCACGGCAGGCAGCCCCGGGG - Intergenic
1146170265 17:30626485-30626507 GACCACGGCAGGCAGCCCCGGGG + Intergenic
1146343720 17:32042515-32042537 GACCACGGCAGGCAGCCCCGGGG + Intronic
1146931123 17:36778696-36778718 GGCTAAGCCAGGCGGCCCCGTGG + Intergenic
1149319334 17:55468552-55468574 GACCAAGGCAGGCATCCCCACGG - Intergenic
1149530890 17:57394392-57394414 GACTAAGTCAGGCAACTCATGGG + Intronic
1151309571 17:73285215-73285237 GATGAAGTCAGGCAGCCAGTCGG + Exonic
1156439735 18:37172411-37172433 GGCCAAGTCAGGCAGTTCCTGGG + Intronic
1158357545 18:56638200-56638222 GCCTAATTCCGGCAGCTCCTGGG + Intronic
1163209414 19:15829561-15829583 GACCAAGGCAGGCATCCCCAAGG - Intergenic
1165020711 19:32921803-32921825 GACTGGCTCAGGCAGCTCCTGGG - Intronic
1166901558 19:46067793-46067815 GAGTCAGTCAGCCAGCCCCCAGG + Intronic
925434023 2:3820504-3820526 GACCAAGGCAGGCAGCCCCGTGG + Intronic
925521463 2:4750468-4750490 GACAAAGGCAGGCAGGTCCTTGG - Intergenic
929684715 2:44023683-44023705 GACCAAGGCAGGCATCCCCGTGG + Intergenic
932624778 2:73288738-73288760 TTCTAAGTCAGACAGCCCCATGG - Intergenic
933137760 2:78758955-78758977 GACTAAGACAGGCATCCCCGTGG - Intergenic
934593104 2:95575974-95575996 GATTTATTCAGGCAGCCCATGGG - Intergenic
937223058 2:120353154-120353176 GACCAGGTCAGCCAGCCCCAAGG - Intergenic
938011185 2:127830288-127830310 TACTAAGGCCAGCAGCCCCTAGG + Intergenic
938620336 2:133045586-133045608 CACTATTTCAGGCATCCCCTGGG - Intronic
938638309 2:133252695-133252717 GCCAAAGTCAGGCTGCCCATGGG + Intronic
938930717 2:136084288-136084310 GGCGAACTCAGGCAGGCCCTTGG - Intergenic
938967809 2:136404116-136404138 GGCTAAGGCAGGCTGCCCCAAGG - Intergenic
941579315 2:167274761-167274783 AACTAAGTCAGTCATCTCCTCGG - Intergenic
943228363 2:185210327-185210349 CACTAAGACAGGCATACCCTTGG - Intergenic
945985754 2:216352271-216352293 GGCTAAGTAAGGCAGCCTCCTGG + Intronic
948252077 2:236537277-236537299 GACCAAGGCAGGCTGCCCCTGGG - Intergenic
948563418 2:238868469-238868491 GGCTAAGTCAGGCAGACTCAAGG + Intronic
948809088 2:240465869-240465891 GACCAAGGGAGGCAGCCCCAGGG + Intronic
1169757642 20:9060426-9060448 GACCAAGTCACACAGCCTCTCGG + Intergenic
1172809563 20:37637518-37637540 GACTAACTCAGGTTGCTCCTTGG + Intergenic
1173596606 20:44262580-44262602 GCCCCAGGCAGGCAGCCCCTGGG + Intronic
1175901078 20:62360136-62360158 GACCAAGGCTGGCAGCCCCCTGG + Intronic
1178508833 21:33185238-33185260 GAGGAAGCCAGGCAGCCCCATGG + Intergenic
1179962284 21:44774992-44775014 GAGGAAGCCAGGCAGGCCCTCGG - Intronic
1181484860 22:23224203-23224225 AACCAATTCAGGCAGCCACTTGG - Intronic
1181544768 22:23595868-23595890 GACTCAGACAGGAAGACCCTAGG + Intergenic
1181616634 22:24059475-24059497 GACTAATCCAGGCAGACTCTTGG - Intronic
1183396881 22:37576760-37576782 GTTTCAGTCAGGCAGCCCCCAGG - Intronic
1183723106 22:39573646-39573668 CACTGAGTGAGCCAGCCCCTGGG + Intronic
1184033345 22:41907352-41907374 TGCCAAGTCACGCAGCCCCTTGG - Intergenic
1184743123 22:46440624-46440646 GACAAACTCAGGCAGCTTCTAGG - Intronic
952791797 3:37206255-37206277 GACCAAGTTAGGCATCCCCACGG - Intergenic
953841373 3:46392566-46392588 GACCAAGGCAGGCATCCCCCCGG + Intergenic
955639357 3:61065901-61065923 GACTAAGACAGTCACCCTCTAGG - Intronic
959543884 3:107571291-107571313 GACCAAGGCAGGCATCCCCACGG + Intronic
960683649 3:120274891-120274913 CACTGGCTCAGGCAGCCCCTTGG - Intronic
973633039 4:52837473-52837495 GACTAGATCACCCAGCCCCTGGG - Intergenic
984517389 4:180757612-180757634 GACTGTGGCTGGCAGCCCCTAGG + Intergenic
985859068 5:2456090-2456112 GACCAAGCCAGGCCGCTCCTGGG + Intergenic
986456535 5:7926411-7926433 GACTCAGTCATGAAGCCTCTAGG - Intergenic
986915384 5:12613421-12613443 GAAGTAGTCAGGCTGCCCCTTGG + Intergenic
991344461 5:65648663-65648685 GACTAAGTAAGGCAGGGGCTAGG - Intronic
991447674 5:66717528-66717550 GTCTCAGCCAGGCAGTCCCTTGG + Intronic
1000654675 5:163861910-163861932 GACTAAGTCAGGAAGCCCTATGG - Intergenic
1002522353 5:179798767-179798789 GACTAAGTCAGGCAGCCCCTAGG - Intronic
1007084771 6:39135652-39135674 GACCAAGGCAGGCATCCCCGCGG + Intergenic
1007716424 6:43858759-43858781 GACAAACTCAGCAAGCCCCTTGG + Intergenic
1013591560 6:111623241-111623263 TACTGAGGCTGGCAGCCCCTTGG + Intergenic
1018000240 6:159572430-159572452 CACGAAGTCTGGCAGGCCCTGGG + Intergenic
1018634283 6:165847187-165847209 GACTAACTCAGCCACCTCCTAGG - Intronic
1019472230 7:1227187-1227209 AACAAAGTCAGGCAGGGCCTGGG + Intergenic
1021767336 7:23963143-23963165 GACTAAGCCAGGCAGGACCCTGG + Intergenic
1022447224 7:30480329-30480351 GACCAAGGCAGGCATCCCCACGG - Intergenic
1026427925 7:70315184-70315206 GGCAAAGTCAGGCAGTCCATGGG - Intronic
1027186937 7:75978024-75978046 GAGTATGTGAGCCAGCCCCTAGG + Intronic
1027354227 7:77340747-77340769 GACCAAGGCAGGCATCCCCACGG - Intronic
1030978051 7:116151869-116151891 TACTAATTCAGGAAGCACCTTGG + Intronic
1032606959 7:133366059-133366081 GACCAAGTAAGGCAGCTTCTTGG + Intronic
1034679857 7:152920415-152920437 GACAGAGGCAGGCAGCCCCTCGG + Intergenic
1037843105 8:22259614-22259636 GACTAAGACAGGGAGCTCCCAGG + Intergenic
1039440946 8:37595030-37595052 AATGAAGTCAGGCAGGCCCTGGG - Intergenic
1039499174 8:38003294-38003316 GATTAAGGCAGGCATCCCCGCGG + Intergenic
1039608064 8:38899223-38899245 GAGTGACTCAGGCAGCCCCACGG + Intergenic
1040754316 8:50753055-50753077 GACAAAGTGAGGCAACCCCCTGG - Intronic
1045331744 8:101161480-101161502 GATTATGGCTGGCAGCCCCTAGG + Intergenic
1047883804 8:129225673-129225695 AAGTTAGTCAGGCAGCCTCTTGG + Intergenic
1049850904 8:144829599-144829621 GACTAGGTGAGGCTGCACCTTGG + Exonic
1053060148 9:35024268-35024290 GACCAAGGCAGGCATCCCCGCGG + Intergenic
1053133960 9:35637743-35637765 GACCAAGGCAGGCATCCCCGTGG - Intronic
1056391699 9:86146892-86146914 GACCAAGGCAGGCATCCCCACGG - Intergenic
1056738639 9:89233173-89233195 TACTGAGTCAAGCAGCACCTTGG + Intergenic
1057261173 9:93585671-93585693 GCCTGAGTCTGGCAGCCCCAGGG - Intronic
1057424681 9:94938677-94938699 GGCTAAGTCATGGAGCTCCTCGG + Intronic
1059841524 9:118222780-118222802 GACTTACTCAGGCAGCTGCTGGG + Intergenic
1061082718 9:128381857-128381879 GAGTAATTCAGGGAGCCTCTTGG - Intronic
1061727949 9:132591359-132591381 AATTAAGTCAAGGAGCCCCTCGG + Intergenic
1186293613 X:8125197-8125219 GAGTAAGTCAGATAGCCCCTGGG + Intergenic
1187874240 X:23790641-23790663 GACTATGGCAGGAAGCCCCAGGG - Intergenic
1190955166 X:55186119-55186141 GACTGAGGCTGGCAGCCCCTAGG + Intronic
1192261223 X:69506708-69506730 GGAGAAGACAGGCAGCCCCTGGG - Intronic
1193012460 X:76692160-76692182 GATTAAATCAGGAAGTCCCTAGG - Intergenic
1195291480 X:103434598-103434620 GACCAAGGCAGGCATCCCCACGG + Intergenic
1195884407 X:109624613-109624635 GGCGAGGGCAGGCAGCCCCTCGG + Exonic
1196123149 X:112071500-112071522 GAATAAGTTAGCCAGCCCTTAGG - Intronic
1198159385 X:133991717-133991739 CTGCAAGTCAGGCAGCCCCTGGG - Intergenic
1198312099 X:135433948-135433970 GATTAGGTCAAGAAGCCCCTCGG + Intergenic
1202255380 Y:22915163-22915185 TACTAAGTCAGTCAGCAGCTGGG - Intergenic
1202408371 Y:24548912-24548934 TACTAAGTCAGTCAGCAGCTGGG - Intergenic
1202462411 Y:25121168-25121190 TACTAAGTCAGTCAGCAGCTGGG + Intergenic