ID: 1002522355

View in Genome Browser
Species Human (GRCh38)
Location 5:179798778-179798800
Sequence TACCTTGTGAGGACTAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002522355_1002522357 -8 Left 1002522355 5:179798778-179798800 CCTGACTTAGTCCTCACAAGGTA 0: 1
1: 0
2: 1
3: 4
4: 80
Right 1002522357 5:179798793-179798815 ACAAGGTAGCTACCATTACGAGG 0: 1
1: 0
2: 1
3: 3
4: 33
1002522355_1002522362 26 Left 1002522355 5:179798778-179798800 CCTGACTTAGTCCTCACAAGGTA 0: 1
1: 0
2: 1
3: 4
4: 80
Right 1002522362 5:179798827-179798849 TGCGGAAACTGAAGAACGTGAGG 0: 1
1: 0
2: 0
3: 16
4: 108
1002522355_1002522359 8 Left 1002522355 5:179798778-179798800 CCTGACTTAGTCCTCACAAGGTA 0: 1
1: 0
2: 1
3: 4
4: 80
Right 1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG 0: 1
1: 0
2: 0
3: 6
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002522355 Original CRISPR TACCTTGTGAGGACTAAGTC AGG (reversed) Intronic
900433805 1:2617029-2617051 TTCCTTGTGATGATTAAGTGAGG - Intronic
902330314 1:15728060-15728082 TACTCTGTGAGGGCCAAGTCAGG - Exonic
905264487 1:36741913-36741935 CAGCTTGTGAGGACCAAGTCAGG + Intergenic
907510010 1:54950932-54950954 TAACTTGTGAAGACTAAGTCAGG - Intergenic
907592613 1:55690279-55690301 TAGCTGGTGGGGACTAAGCCTGG + Intergenic
911205120 1:95084834-95084856 CTCCTTGTGAGACCTAAGTCTGG - Intergenic
912356573 1:109059036-109059058 TACTTTGGCAGGACTAAGGCAGG + Intergenic
913255309 1:116947790-116947812 TCATTTGTGAGGACTAAGTATGG - Intronic
918025489 1:180740881-180740903 TACCATGTGAGGACACAGTGAGG - Intronic
918219272 1:182421123-182421145 TTGCTTTTGAGGACTCAGTCAGG + Intergenic
919572089 1:199261451-199261473 TTCCTTCTGAGGGCTGAGTCTGG - Intergenic
923686295 1:236155865-236155887 TGCCTTGTGAGGACCAAGGTAGG + Intronic
1068351928 10:55858886-55858908 TACCTTCTGAGAAATGAGTCAGG + Intergenic
1076335899 10:129706275-129706297 TACCTTGTGTGGACAGAGTTGGG + Intronic
1080390014 11:31836259-31836281 TCCCTTCTGAGGACTCAGTCTGG - Intronic
1082686526 11:56244924-56244946 CACTTTGGGAGGCCTAAGTCGGG + Intergenic
1084578177 11:70004160-70004182 GCCCTTGTGAAGACAAAGTCAGG - Intergenic
1088019034 11:105096886-105096908 TACCTTGATAGGACTAAGAAAGG - Intronic
1089922812 11:122226959-122226981 TAGCAAGTGAGGTCTAAGTCAGG - Intergenic
1092753695 12:11743127-11743149 TACCGTGTGACGACAAAGGCTGG + Intronic
1093557088 12:20489283-20489305 TGCCTAGTGAAGACTGAGTCTGG + Intronic
1097580309 12:61447553-61447575 AACCCTGGGAGGACTGAGTCGGG - Intergenic
1107673331 13:42769393-42769415 TACCATGTGAGGACACAGTGAGG - Intergenic
1112129240 13:96503323-96503345 TGCCATGTGAGGCCTAGGTCAGG + Intronic
1118776247 14:68976096-68976118 TACTTTGTGAGCACTCATTCTGG - Intronic
1126240739 15:46440216-46440238 TACCTTGTGAAAACTAAGGGAGG + Intergenic
1128391555 15:67186056-67186078 TAACTGGTGAGGACTAAATGAGG - Intronic
1133110995 16:3548350-3548372 GACCCTCTGAGAACTAAGTCTGG - Intronic
1134484606 16:14647448-14647470 TACCTTGGGAGGACCGAGGCAGG + Intronic
1139076703 16:63459425-63459447 TACTTTGTGAGAGCTAATTCTGG + Intergenic
1140756056 16:78067823-78067845 TACCCTTTGAGAATTAAGTCAGG + Intergenic
1146524142 17:33551762-33551784 TCCCTTGTGAGGACAATATCTGG - Intronic
1147716719 17:42513632-42513654 TCCCAGGTGAGGGCTAAGTCAGG + Intronic
1151901604 17:77019654-77019676 TACTGTGTGAGGACAAAGTGAGG - Intergenic
1154295370 18:13142412-13142434 TACCCAGTGAGGGCCAAGTCAGG - Intergenic
1158074137 18:53509037-53509059 TCCATTGTGAGGAGCAAGTCGGG - Intronic
1159154441 18:64564735-64564757 TACCTTGGGAGGCCGAGGTCGGG - Intergenic
1164579352 19:29424959-29424981 TACCATGTGAGGACACAGTGAGG - Intergenic
1166356786 19:42232054-42232076 TACCTTGTGAGGACGGGGTGAGG + Exonic
928656311 2:33455342-33455364 TCCCTTGAGTGGATTAAGTCAGG + Intronic
932080983 2:68715099-68715121 AACCTTGTGAGCAGGAAGTCAGG + Intronic
936856403 2:116963323-116963345 TTCCTTGTGTTGACCAAGTCAGG - Intergenic
936978953 2:118246276-118246298 TATTGTGTCAGGACTAAGTCAGG + Intergenic
1173262755 20:41451341-41451363 TACCCTGTGAGGATTAAGAAAGG + Intronic
1181840826 22:25659018-25659040 TATATTCTGATGACTAAGTCTGG - Intronic
1182438155 22:30344551-30344573 CTTCTTGTGAGGACTAAGTTAGG + Intronic
949735886 3:7171166-7171188 TTCCTTCTGAGGACCAAGACAGG + Intronic
950576925 3:13837632-13837654 GATCTTCTGTGGACTAAGTCAGG - Intronic
953061076 3:39429265-39429287 TGCCTGATGGGGACTAAGTCTGG + Intergenic
956026605 3:64989162-64989184 TTCTTTGTGATGACCAAGTCGGG + Intergenic
962749339 3:138422009-138422031 TACCTTGTGAAGACAAAGGCAGG + Intergenic
963306190 3:143655908-143655930 TAACTTATGAGGTCTAAGTGAGG + Intronic
964752920 3:160068722-160068744 CACCTTGTGAGGACTCAGCGAGG + Intergenic
966086274 3:176070487-176070509 TACCCTGTGAGGTTTAAGGCAGG - Intergenic
968589703 4:1451181-1451203 TTCCTTGTGAGGACCAGGTGTGG + Intergenic
969484871 4:7466647-7466669 TAGCTGGTGAGGACTGAGCCCGG + Intronic
974322280 4:60367090-60367112 TAACTTCTTAGGACTGAGTCAGG - Intergenic
979131546 4:117053022-117053044 TACGTTCTGAGGACTAACTCTGG + Intergenic
980275629 4:130646565-130646587 TGCCTTTTCAGGACTAAATCAGG + Intergenic
986446696 5:7827423-7827445 TAGGCTGTGAGGACTAATTCTGG - Exonic
986688651 5:10295930-10295952 TAGCATGTGAGCACTAAGTGCGG - Intronic
987645150 5:20661078-20661100 TACCTTGTGTGAACTCAGTTGGG + Intergenic
997025555 5:130056712-130056734 TAGCTAGTAAGGACTGAGTCAGG - Intronic
997756402 5:136403571-136403593 AACCATGTGAGGACCAAGGCAGG + Intergenic
999424827 5:151478100-151478122 AACCTTGTAAAGACTGAGTCTGG - Intronic
999932445 5:156448323-156448345 TACCTTGTGCAGACTTAGGCAGG - Intronic
1002090771 5:176804543-176804565 TACTTTGTGAGGGATAAGACAGG - Intergenic
1002522355 5:179798778-179798800 TACCTTGTGAGGACTAAGTCAGG - Intronic
1002586307 5:180250913-180250935 TCCGCTGTGAGGACCAAGTCAGG + Intronic
1011959980 6:93076019-93076041 TACCTTATAAGTGCTAAGTCAGG - Intergenic
1014010151 6:116466247-116466269 TCCCTTCTGAGGACTAAGATTGG + Intergenic
1014822376 6:126005439-126005461 TATATTGTGAGGATTAAGTGAGG + Intronic
1019928128 7:4206465-4206487 GACCTTGTGAGGAATGAGACTGG - Intronic
1029016212 7:97317328-97317350 TACTTTGTGAGGAAAAAGTTTGG - Intergenic
1032666816 7:134045058-134045080 CAGGTTGTGAGGACTAAATCAGG + Intronic
1043160996 8:76847254-76847276 TACCTTGTCATAATTAAGTCTGG - Intronic
1047403856 8:124568744-124568766 TTCCTTGTCAGGAATAAGCCAGG - Intronic
1047536067 8:125720631-125720653 AAACTTGTAAGGACCAAGTCTGG + Intergenic
1051276511 9:15404194-15404216 TATTTTGTGAGGATTAAGGCAGG + Intergenic
1056225008 9:84486050-84486072 TATCTTGTGAGGTCTATGTACGG + Intergenic
1056940367 9:90950326-90950348 TTTTTTGTGAGAACTAAGTCAGG - Intergenic
1188108483 X:26169715-26169737 TACCTTATAAAGAATAAGTCAGG - Intergenic
1190623675 X:52314699-52314721 TACCATGTGAGGACACAGTGAGG - Intergenic
1202258211 Y:22942280-22942302 TATCTTGTGTGGCATAAGTCTGG - Intergenic
1202411201 Y:24576038-24576060 TATCTTGTGCGGCATAAGTCTGG - Intergenic
1202459580 Y:25094034-25094056 TATCTTGTGCGGCATAAGTCTGG + Intergenic