ID: 1002522356

View in Genome Browser
Species Human (GRCh38)
Location 5:179798789-179798811
Sequence GTAATGGTAGCTACCTTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002522356_1002522363 27 Left 1002522356 5:179798789-179798811 CCTCACAAGGTAGCTACCATTAC 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1002522363 5:179798839-179798861 AGAACGTGAGGATAACTTGCCGG 0: 1
1: 0
2: 0
3: 2
4: 69
1002522356_1002522362 15 Left 1002522356 5:179798789-179798811 CCTCACAAGGTAGCTACCATTAC 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1002522362 5:179798827-179798849 TGCGGAAACTGAAGAACGTGAGG 0: 1
1: 0
2: 0
3: 16
4: 108
1002522356_1002522359 -3 Left 1002522356 5:179798789-179798811 CCTCACAAGGTAGCTACCATTAC 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG 0: 1
1: 0
2: 0
3: 6
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002522356 Original CRISPR GTAATGGTAGCTACCTTGTG AGG (reversed) Intronic
901658908 1:10786615-10786637 ATAATAGTACCTACCTCGTGGGG - Intronic
902069440 1:13721920-13721942 GTAATGGTGCCTACCCCGTGTGG + Intronic
903874105 1:26460704-26460726 GTAGTGGTAGCTAACATATGAGG + Intronic
904303463 1:29571313-29571335 ATAATAGCATCTACCTTGTGGGG + Intergenic
905018176 1:34791729-34791751 GTGATAGTATCTACTTTGTGGGG - Intronic
906666681 1:47627116-47627138 GTAATAGCATCTACCTTGCGGGG - Intergenic
907340866 1:53735396-53735418 GTAATGGTGCCTACCTTGCAGGG - Intergenic
908438167 1:64127344-64127366 ATAATGCTACCTACCTTGAGGGG + Intronic
908597912 1:65708434-65708456 GAAATGGCAGCTAGCTTGTCGGG - Intergenic
909540002 1:76780653-76780675 GTAATAGAAGCTACTTTGTATGG + Intergenic
912051033 1:105527681-105527703 GTAACAGTAGACACCTTGTGAGG + Intergenic
916657018 1:166885312-166885334 ATAGTAGTACCTACCTTGTGGGG - Intergenic
916873417 1:168941771-168941793 ATAATAATAGCTACCTTATGTGG - Intergenic
919534993 1:198776469-198776491 GGAATAATAGCTACCTTTTGAGG - Intergenic
919770669 1:201156281-201156303 GTGATGATAGCTACCTCCTGGGG - Intronic
920410568 1:205756958-205756980 GTAATCTCAGCTACCTTGGGAGG - Intergenic
922133194 1:222799288-222799310 GTGATGGAAGCTATCATGTGTGG - Intergenic
924552885 1:245094837-245094859 GTAATGGTGGTTAACTTCTGTGG - Intronic
1065010232 10:21414414-21414436 GTAATCCTAGCTACCTGGGGAGG + Intergenic
1065261546 10:23928690-23928712 ATAATGGTATCTACCTCATGAGG - Intronic
1065271153 10:24035207-24035229 ATAATGGTGTCTACCTTGTCAGG + Intronic
1065676774 10:28184015-28184037 ATAATAGTACCTACTTTGTGTGG - Intronic
1067320539 10:45216508-45216530 GCTATGGTAGCTACCCTGTCTGG - Intergenic
1068482255 10:57606880-57606902 ATAATAGTACCTACCTTGTAAGG + Intergenic
1069041600 10:63701486-63701508 GTAATCTCAGCTACCTTGGGAGG - Intergenic
1074078597 10:110150899-110150921 GTAATGGTGCCTACCCCGTGGGG - Intergenic
1075880288 10:125845370-125845392 ATAATGTCAGCTACCTTGAGAGG - Intronic
1078920727 11:15827734-15827756 TTAATGATAGCTTCCTTGTAGGG + Intergenic
1079787792 11:24697494-24697516 GCAAAGGTAGTTAGCTTGTGAGG - Intronic
1079964266 11:26961439-26961461 GTATTGGAAGATACATTGTGAGG - Intergenic
1079974719 11:27076971-27076993 GTCATGGTAGCTGTCTTCTGGGG - Intronic
1080546113 11:33320384-33320406 GTAAAGGTGGTTACATTGTGAGG + Intronic
1083316884 11:61820776-61820798 GTAATCCCAGCTACTTTGTGGGG + Intronic
1087106891 11:94418588-94418610 GTAATGGAAGCTACCAGGGGAGG - Exonic
1087465613 11:98500910-98500932 GTAATGGTAGCTACATTAGAGGG - Intergenic
1087789498 11:102391679-102391701 GCAATGGTGGCTACACTGTGGGG + Intergenic
1088194859 11:107263032-107263054 GTAATGCTAGCCACCGTGTCCGG + Intergenic
1089654519 11:119936999-119937021 GTAATAGTAGTTACCTTGCAGGG - Intergenic
1090410081 11:126501942-126501964 GTAATGGCTGCTCCCTTGGGCGG - Intronic
1093841699 12:23910519-23910541 GTTATGGTAGCTATCTTTGGGGG - Intronic
1095653363 12:44640290-44640312 ATAATAGCATCTACCTTGTGGGG - Intronic
1100023767 12:90102616-90102638 TTAATGGTACATACCTTATGTGG - Intergenic
1100275901 12:93071647-93071669 GTAATGGTACCCATCTCGTGGGG - Intergenic
1109285221 13:60400614-60400636 GTAATCCCAGCTACCTGGTGAGG + Intronic
1109392028 13:61706172-61706194 TTAATAGTAGCCATCTTGTGGGG - Intergenic
1110584657 13:77174725-77174747 GTAATGATACTTACCTTATGAGG - Intronic
1112966752 13:105206167-105206189 GTAATGTGAGATACTTTGTGTGG - Intergenic
1119060125 14:71465192-71465214 GTAATGGTAGACACCTGATGAGG + Intronic
1119082580 14:71709656-71709678 GGAAGGGTGGTTACCTTGTGTGG - Exonic
1119183460 14:72619745-72619767 GTCGTCGTACCTACCTTGTGGGG + Intronic
1119411443 14:74433705-74433727 ATAATGGTACCTACCTTGTGGGG - Intergenic
1121025696 14:90614715-90614737 GTAACGGTAGCTATCTTGCAAGG + Intronic
1121987659 14:98523499-98523521 GAAATGGGTGTTACCTTGTGAGG - Intergenic
1125457303 15:39873166-39873188 GTTATAGTACCTACTTTGTGAGG - Intronic
1126712658 15:51477559-51477581 GTAATGGTAGCAGCCTTTTGTGG - Intronic
1127370502 15:58334478-58334500 ATAATGATATCCACCTTGTGAGG - Intronic
1128442664 15:67727076-67727098 GTAATCCCAGCTACCTTGGGAGG + Intronic
1129488110 15:75896196-75896218 GTAATAGTGGTTAACTTGTGTGG + Intronic
1129755601 15:78097188-78097210 GGAATGGTGGCTACCTTTAGGGG + Intronic
1130015595 15:80183779-80183801 GTAAGAGTAGCTGCCTTGTTTGG - Intronic
1130981986 15:88818970-88818992 GGAAAGGTAGCTTCCTAGTGAGG + Intronic
1131661813 15:94525245-94525267 GTGAAGATAGCTAGCTTGTGAGG + Intergenic
1134197401 16:12169738-12169760 GTAATGCCAGCTACTTTGGGAGG + Intronic
1134602896 16:15547461-15547483 GTAATCCTAGCTACTTTGGGAGG - Intronic
1135891696 16:26363249-26363271 ATAATGTTAGCTACATCGTGAGG + Intergenic
1139322141 16:66123385-66123407 GTAATAGTAGCTAAATTTTGGGG - Intergenic
1140193016 16:72834124-72834146 GTAGTCGTAGCTAACTTGGGAGG + Intronic
1143525807 17:7471733-7471755 TTAATAGTTCCTACCTTGTGGGG + Intronic
1147410430 17:40247337-40247359 GTAATCCTAGCTACCTTGGGAGG - Intronic
1147730964 17:42601752-42601774 GTAATCCCAGCTACCTTGGGAGG - Intronic
1150960280 17:69904933-69904955 GTAATCCCAGCTACCTTGGGAGG + Intergenic
1153050920 18:902395-902417 GTAAAGGGAGCCACCATGTGGGG - Intergenic
1153920044 18:9780807-9780829 GTAATCCCAGCTACCTTGGGAGG + Intronic
1155721219 18:29014198-29014220 GTTAAGGTAGCTAGCTTTTGTGG + Intergenic
1157485845 18:48086268-48086290 ATAATAGTATCTACCTTATGAGG - Intronic
1159097350 18:63919357-63919379 ATACTGGTAGCTTCCTTCTGTGG - Intronic
1159504893 18:69323307-69323329 GCACTGGTATCTATCTTGTGAGG - Intergenic
1160619210 18:80159108-80159130 GTAATCCCAGCTACCTTGGGAGG - Exonic
1163419768 19:17207374-17207396 GTAATCCTAGCTACTTTGGGAGG + Intronic
1166779865 19:45336068-45336090 GTAATAGTGCCTACCTTGGGGGG + Intronic
1167193126 19:48005870-48005892 GTAATGGTACCTACCACGTTGGG + Intronic
1167478854 19:49716803-49716825 GTAATCCTAGCTAACTTGAGAGG - Intergenic
926821263 2:16854110-16854132 GTAATGGTGGCTACCCTGGCTGG + Intergenic
927963921 2:27257620-27257642 GTAATGCTACCTACCTCATGGGG + Intronic
928968331 2:36999755-36999777 GTAATGCTAGCAACTTTGGGAGG + Intronic
929487563 2:42368646-42368668 GGAATGATATCTACTTTGTGAGG + Intronic
930699375 2:54444159-54444181 ATAATGGTACCTACATCGTGGGG + Intergenic
931289100 2:60856760-60856782 GTCATGGTATGTACCTTGAGGGG + Intergenic
931522106 2:63109553-63109575 GTAATGGTAGCTTCATAGAGTGG + Intergenic
935073490 2:99716758-99716780 GTAATCGCAGCTACTTTGGGGGG + Intronic
941140212 2:161771160-161771182 GTAATGGTAGCTTACTGGGGAGG + Intronic
941949600 2:171140054-171140076 GTACTGGTCGCTATCCTGTGAGG - Intronic
942605342 2:177684667-177684689 GTAATGGGATCTGCCTTGTAGGG + Intronic
947075818 2:226344435-226344457 TTAATAGTACCTACCTTGTAGGG + Intergenic
947621665 2:231594764-231594786 ATAATGGCAGCCACCATGTGTGG - Intergenic
1170022112 20:11847805-11847827 GTAATGGTAGTTAGGTTGTTTGG + Intergenic
1170611354 20:17916244-17916266 GTAATCCCAGCTACCTGGTGAGG + Intergenic
1172425577 20:34853730-34853752 ATAATGGTATCAACCTTGTAAGG - Intronic
1174159286 20:48539347-48539369 GTAATTGTACCTACCTTCTCTGG - Intergenic
1174795905 20:53522466-53522488 GTAATCCTAGCTACCTGGTGGGG - Intergenic
1178040463 21:28635221-28635243 GTAATGCCAGCTAGCTTGGGAGG - Intergenic
1180839856 22:18954223-18954245 GGAATGGGAGCTACTTGGTGGGG + Intergenic
1181062039 22:20286256-20286278 GGAATGGGAGCTACTTGGTGGGG - Intergenic
1182315597 22:29444857-29444879 GTAATGATACCTACTTTGTAGGG - Intergenic
1183101716 22:35588284-35588306 GTAATGGTACCTGCCTTGCAAGG - Intergenic
1183316912 22:37141926-37141948 ATAATGGCACCTACCTTGTTGGG - Intronic
949103161 3:170570-170592 ATAATTGTAGCTACCTTTTATGG - Intergenic
949304543 3:2625030-2625052 ATAATAGTAGCTACCTTATAGGG + Intronic
949467068 3:4354908-4354930 ATAATAATACCTACCTTGTGGGG - Intronic
951573260 3:24087702-24087724 ATAATGGTACCTACCTTATGGGG + Intergenic
952598042 3:35043236-35043258 GTAATGGCAGCCACCTTGCCAGG + Intergenic
955192881 3:56778226-56778248 GTAGTAGTAGTTACCTTGTGAGG - Intronic
955638735 3:61058804-61058826 ATAATGGTACCTACCATGTAAGG - Intronic
955953852 3:64268075-64268097 GGAATGTTACCTGCCTTGTGCGG - Intronic
956058701 3:65328007-65328029 ATAATTGTAACTACCTTATGGGG + Intergenic
956235514 3:67066324-67066346 GTAATCCTAGCTACGTTGGGAGG + Intergenic
957448842 3:80349672-80349694 TTAACAGTAGATACCTTGTGAGG - Intergenic
957587991 3:82157713-82157735 GTAAAGGTAGTTAGCTTTTGAGG - Intergenic
962631888 3:137284998-137285020 ATAATAGTATCTACCTTGTAGGG - Intergenic
963127515 3:141828965-141828987 GAAATGCTAGCTGCCTTCTGGGG - Intergenic
963340866 3:144031500-144031522 GTAATGTCACCTACTTTGTGTGG + Intronic
964316751 3:155452934-155452956 TTAATAGTAGATACCTTGTGAGG - Intronic
965662714 3:171058469-171058491 GACATGGTAGTTACCATGTGGGG + Intergenic
966389607 3:179438222-179438244 ATACTGGTACCTACCTTCTGAGG - Intronic
970387830 4:15573801-15573823 ATAATAGTATCTACTTTGTGGGG - Intronic
971385053 4:26134684-26134706 GAAATGGAAGCTACCCTTTGAGG + Intergenic
971851176 4:31987895-31987917 GTGATGGTAGCTACCATTTAGGG + Intergenic
975415221 4:74098075-74098097 ATAATGGTAGCTACATCATGAGG - Intronic
977386731 4:96349799-96349821 GTAATAGTAGCTATCTTATAAGG + Intergenic
977684792 4:99835682-99835704 GTGACGGCAGCTACCTTCTGAGG + Exonic
977794014 4:101141102-101141124 GTACTGGGAGCCACCATGTGTGG - Intronic
980645932 4:135642560-135642582 CTAAGGGTATCTACCTTATGGGG - Intergenic
981336978 4:143579622-143579644 ATAATGATAGCTACCTTATAAGG + Intronic
981765523 4:148244405-148244427 GAAATTGTAGCTACTTTGTCAGG + Intronic
982501588 4:156163615-156163637 ATAATGGTACCTACCTTATAAGG + Intergenic
985121480 4:186647319-186647341 GTATTGGTAGCTCCCTTCTAGGG - Intronic
987003158 5:13681711-13681733 GATATGGTACCTTCCTTGTGAGG - Intergenic
988580699 5:32466357-32466379 ATAATAGTACCTACCTTGTAAGG - Intergenic
989139372 5:38188270-38188292 GAAATGGAAGCTACATTATGGGG + Intergenic
991435475 5:66593973-66593995 GTAATAGTAGCTACCTCATTGGG + Intergenic
991598245 5:68326424-68326446 ATAATAGTACCTACCTTGTAGGG - Intergenic
993978927 5:94517985-94518007 ATAATGGTATCTACCTTGTTTGG + Intronic
995528017 5:113066217-113066239 CTAATGAAAGGTACCTTGTGAGG + Intronic
996722763 5:126646416-126646438 GTAATCCTAGCTACTTTGGGAGG - Intergenic
997590523 5:135069340-135069362 GTTTTGGTAGCCACCTTCTGGGG + Intronic
997619305 5:135274476-135274498 GTAATGATACCTTCCTTATGGGG + Intronic
998522621 5:142814628-142814650 GACATGGTAGCTAGCTTGTGAGG + Intronic
1001588990 5:172852736-172852758 GTAATGGTACCTTCCTCCTGGGG + Intronic
1002522356 5:179798789-179798811 GTAATGGTAGCTACCTTGTGAGG - Intronic
1003634723 6:7821697-7821719 GTAATGGTGACTACCATGTGTGG + Intronic
1003780353 6:9417470-9417492 GTAATTGAAGCTACCTTGCCTGG + Intergenic
1003944964 6:11066600-11066622 CTAATAGTAGCTGCCTTTTGAGG + Intergenic
1005314627 6:24592848-24592870 GTAGTCCCAGCTACCTTGTGGGG + Intronic
1005901550 6:30221117-30221139 GTAATCCCAGCTACCTTGGGAGG - Intergenic
1007755447 6:44096328-44096350 GTAATAGTACGTACCTTGTAGGG - Intergenic
1008177571 6:48287871-48287893 GTGGTGGTAGCTACCAGGTGAGG - Intergenic
1009994148 6:70880328-70880350 GTAATAGTATCTACCTAGTGGGG - Intronic
1014496009 6:122123716-122123738 ATAATGGTAGCTGCCCTCTGTGG - Intergenic
1016750548 6:147626596-147626618 ATATTGGTACCTACCTTGTAAGG + Intronic
1017324956 6:153133092-153133114 ATAATAGTATCTACCTTGTAGGG - Intergenic
1018878509 6:167849116-167849138 GTAATAATACCTACCTTATGGGG + Intronic
1022430060 7:30310073-30310095 ATAACAGTAGCTACGTTGTGAGG + Intronic
1023604382 7:41915307-41915329 GCAATGGCAGTTAGCTTGTGAGG + Intergenic
1026980815 7:74525633-74525655 GTAATCTTAGCTACTTTGGGAGG + Intronic
1029276879 7:99410813-99410835 ATAATGGAAGCTACCTTATGTGG - Intronic
1029898163 7:104008256-104008278 GTAATGGTTGCTTTATTGTGTGG - Intergenic
1030421914 7:109317602-109317624 GTAATCCCAGCTACTTTGTGAGG + Intergenic
1040728106 8:50408358-50408380 GCAAAGGTAGTTAGCTTGTGAGG + Intronic
1042379320 8:68094836-68094858 GAAATGGGGGCAACCTTGTGGGG - Intronic
1043257645 8:78156628-78156650 GTAACAGTAGATACCTGGTGAGG - Intergenic
1044568064 8:93687043-93687065 GTAATGGTGCCTATCTCGTGTGG - Intergenic
1046689773 8:117269438-117269460 GTAATCCCAGCTACTTTGTGAGG - Intergenic
1047010832 8:120670853-120670875 GTAATGGTACCTACATTATGGGG - Intronic
1047420462 8:124703770-124703792 ATAATGGTATGTACCTTGTGGGG + Intronic
1047554630 8:125915841-125915863 ATAATAGTACCTACCTTGTGAGG - Intergenic
1049459440 8:142717838-142717860 GTGGTGGTGGCTGCCTTGTGTGG - Intergenic
1050487561 9:6149843-6149865 TTAATAGTAGATACCCTGTGAGG + Intergenic
1051347989 9:16169809-16169831 CTAATAGTATCAACCTTGTGGGG + Intergenic
1052814959 9:33095177-33095199 GTAATCCCAGCTACCTTGGGAGG + Intergenic
1052839377 9:33279043-33279065 GTAATCGCAGCTACCTGGGGTGG - Intronic
1058499495 9:105596744-105596766 ATAATAATAGCTACCTTGTGTGG + Intronic
1059687432 9:116651035-116651057 GTAATCGCAGCTACGTTGGGAGG - Intronic
1185815057 X:3146851-3146873 CTAATGGTTTCCACCTTGTGAGG + Intergenic
1188240922 X:27788800-27788822 TTAATAGTAGCTATCATGTGAGG - Intergenic
1195724180 X:107896981-107897003 ATAATAGTACCTACCTTATGGGG + Intronic
1196033470 X:111116976-111116998 GTAATGGTATCTCCCTAGTGAGG + Intronic
1198778063 X:140202143-140202165 GTAATGGTACCTACCTCTTTAGG - Intergenic
1199806875 X:151308800-151308822 CTAATAGTAGCTCCCTTATGGGG + Intergenic
1201652552 Y:16306396-16306418 ATAATGATGGCTACCTAGTGTGG + Intergenic
1202101949 Y:21318763-21318785 GTAAAGGAATCTACCTTCTGTGG + Intergenic