ID: 1002522359

View in Genome Browser
Species Human (GRCh38)
Location 5:179798809-179798831
Sequence TACGAGGCCCACTTCAGATG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 56}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002522351_1002522359 28 Left 1002522351 5:179798758-179798780 CCCTGAGCTCCTAGGGGCTGCCT 0: 1
1: 0
2: 6
3: 48
4: 283
Right 1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1002522352_1002522359 27 Left 1002522352 5:179798759-179798781 CCTGAGCTCCTAGGGGCTGCCTG 0: 1
1: 1
2: 6
3: 51
4: 310
Right 1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1002522356_1002522359 -3 Left 1002522356 5:179798789-179798811 CCTCACAAGGTAGCTACCATTAC 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1002522353_1002522359 19 Left 1002522353 5:179798767-179798789 CCTAGGGGCTGCCTGACTTAGTC 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1002522355_1002522359 8 Left 1002522355 5:179798778-179798800 CCTGACTTAGTCCTCACAAGGTA 0: 1
1: 0
2: 1
3: 4
4: 80
Right 1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG 0: 1
1: 0
2: 0
3: 6
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002522359 Original CRISPR TACGAGGCCCACTTCAGATG CGG Intronic
902579483 1:17399138-17399160 TGTGAGGCCCACTTCGGATGGGG + Intronic
905528604 1:38658687-38658709 TACAAAACCCACTTCAGATGGGG - Intergenic
907908661 1:58808343-58808365 TAGGAGAGCCACTCCAGATGTGG - Intergenic
912563230 1:110565354-110565376 TATTAGGTCCACTTCAGAGGTGG + Intergenic
1067545179 10:47187792-47187814 GACCAGGCCCACTTCACCTGGGG - Intergenic
1067786846 10:49256469-49256491 CAGGAGCCCCACTCCAGATGGGG - Intergenic
1072985554 10:100136669-100136691 CAAGAGGCCCTCATCAGATGTGG + Intergenic
1077534929 11:3119489-3119511 AAGGGGGCCCACTTCAGGTGGGG + Intronic
1078766382 11:14302560-14302582 TCCAATGCCCACTTCAGATGTGG + Intronic
1081403077 11:42665338-42665360 AAGGAGGCTCTCTTCAGATGAGG - Intergenic
1081531470 11:43962879-43962901 TCTGACACCCACTTCAGATGAGG + Intergenic
1083638224 11:64131734-64131756 TGCCAGGCCCTGTTCAGATGGGG + Intronic
1089279505 11:117363434-117363456 TAAGAGGCTCACTTGAGCTGTGG - Exonic
1091009376 11:131984551-131984573 CACAATGACCACTTCAGATGTGG - Intronic
1091862648 12:3800381-3800403 TATGAGGCAGATTTCAGATGTGG + Intronic
1092901059 12:13059703-13059725 TCTGAGGCCCACATGAGATGTGG + Intronic
1105255816 13:18743565-18743587 AGGGAGTCCCACTTCAGATGTGG - Intergenic
1113174538 13:107547184-107547206 TATGAGGCACTCTTCTGATGTGG - Intronic
1122238575 14:100346722-100346744 TAAGAGGCCCACTGCTGCTGTGG - Intronic
1127045252 15:55018360-55018382 TAGGAGGACCACTTGAGTTGAGG - Intergenic
1138589718 16:57993231-57993253 CACCAGGCCTGCTTCAGATGGGG + Intergenic
1139438601 16:66951709-66951731 TTGGAGGACCACTTCACATGTGG + Intergenic
1145023913 17:19453396-19453418 CACGAGGCCCACAGCAGCTGGGG - Intergenic
1149251410 17:54774298-54774320 TACGATCCCCTTTTCAGATGAGG - Intergenic
1152665824 17:81568771-81568793 TACGAGGTCCACTGAAGATGTGG + Intronic
1153029156 18:697521-697543 CAGGAGGACCACTTGAGATGAGG + Intronic
1153707104 18:7757171-7757193 TAAAAGGCCTACTTCAGATTAGG - Intronic
1162397831 19:10427730-10427752 TACTAGGCCCATTTCAGAGACGG - Intronic
1165106558 19:33473197-33473219 TAGGAGTCCCACTTCCCATGTGG + Intronic
1168713205 19:58513268-58513290 TCGGAGACCCACCTCAGATGTGG + Intergenic
927548916 2:23979659-23979681 TAGGAGGACCACTTGAGACGGGG - Intronic
931791649 2:65669021-65669043 TCCAAGGCCCTTTTCAGATGTGG + Intergenic
942657439 2:178229024-178229046 CACGAGGCCCTCATCAGATGTGG - Intronic
946484633 2:220089200-220089222 TACCAGGAGCACTGCAGATGAGG - Intergenic
948888014 2:240893464-240893486 TGCGTGGCCCACGGCAGATGAGG - Intronic
1175031029 20:55954251-55954273 CACGAGGCCCTCACCAGATGTGG - Intergenic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
956856782 3:73282951-73282973 CATAAGGCCCACTCCAGATGTGG - Intergenic
961668702 3:128510683-128510705 CCCAATGCCCACTTCAGATGTGG - Intergenic
962665888 3:137653275-137653297 TTCAATGCGCACTTCAGATGTGG + Intergenic
962725369 3:138220780-138220802 TAGGAGGATCACTTCAGCTGGGG - Intronic
964747303 3:160024420-160024442 GAAGATGCCCACTTCATATGCGG + Intronic
970420579 4:15902129-15902151 TGAGAGGCCAACTTCAGAAGGGG - Intergenic
982392077 4:154875810-154875832 CTCGACACCCACTTCAGATGTGG + Intergenic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1006530960 6:34653451-34653473 TGGGAGGATCACTTCAGATGAGG - Intronic
1016737049 6:147490477-147490499 TTCCAGCCCCACTTCAGAAGAGG - Intergenic
1022782346 7:33599139-33599161 TAAGAGGCCCAATTCACCTGGGG + Intronic
1024632279 7:51259721-51259743 TCCCAGGCAGACTTCAGATGTGG + Intronic
1028832138 7:95339935-95339957 TTCAAGACCCACTTCAGAGGTGG + Intergenic
1028907971 7:96175999-96176021 TCTGAGGCCCACTACAGATGTGG + Intronic
1033495417 7:141889109-141889131 TATTAGGCCAGCTTCAGATGAGG + Intergenic
1038028133 8:23610432-23610454 TAAGAGGTACACTTAAGATGGGG - Intergenic
1045549183 8:103154886-103154908 TAAGAGGCCCACATCACAGGTGG - Intronic
1047401099 8:124548163-124548185 TCAGAAGCCAACTTCAGATGTGG + Intronic
1054712428 9:68524676-68524698 GATGAGTCCCACATCAGATGAGG - Intronic
1056299317 9:85225653-85225675 TATGAGGCCCTCTGAAGATGAGG + Intergenic
1057723639 9:97553448-97553470 TACAAGGCTCCCTGCAGATGTGG - Intronic
1061442597 9:130616459-130616481 GACCAGACCCACTTTAGATGCGG - Exonic
1061853810 9:133430472-133430494 TACCAGCCCCACTTCTGCTGTGG - Intronic
1062438270 9:136556739-136556761 TCCTGGGCCCACTGCAGATGGGG - Intergenic
1188513559 X:30961603-30961625 TACTGGGCCCACTTCTGAAGTGG + Intronic
1190101931 X:47528563-47528585 TAGGAGGACCACTTGAGCTGGGG - Intergenic