ID: 1002522618

View in Genome Browser
Species Human (GRCh38)
Location 5:179800050-179800072
Sequence GCAGCTGGAGGATGACATCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 188}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002522618_1002522626 0 Left 1002522618 5:179800050-179800072 CCACGATGTCATCCTCCAGCTGC 0: 1
1: 0
2: 1
3: 15
4: 188
Right 1002522626 5:179800073-179800095 GAGGTGAGCAGAGAGGGGCTGGG 0: 1
1: 0
2: 11
3: 79
4: 815
1002522618_1002522631 23 Left 1002522618 5:179800050-179800072 CCACGATGTCATCCTCCAGCTGC 0: 1
1: 0
2: 1
3: 15
4: 188
Right 1002522631 5:179800096-179800118 GCTGAGGAAGGGCACCCAGATGG 0: 1
1: 1
2: 2
3: 44
4: 344
1002522618_1002522623 -6 Left 1002522618 5:179800050-179800072 CCACGATGTCATCCTCCAGCTGC 0: 1
1: 0
2: 1
3: 15
4: 188
Right 1002522623 5:179800067-179800089 AGCTGCGAGGTGAGCAGAGAGGG 0: 1
1: 0
2: 3
3: 24
4: 339
1002522618_1002522624 -5 Left 1002522618 5:179800050-179800072 CCACGATGTCATCCTCCAGCTGC 0: 1
1: 0
2: 1
3: 15
4: 188
Right 1002522624 5:179800068-179800090 GCTGCGAGGTGAGCAGAGAGGGG 0: 1
1: 0
2: 5
3: 43
4: 457
1002522618_1002522630 12 Left 1002522618 5:179800050-179800072 CCACGATGTCATCCTCCAGCTGC 0: 1
1: 0
2: 1
3: 15
4: 188
Right 1002522630 5:179800085-179800107 GAGGGGCTGGGGCTGAGGAAGGG 0: 1
1: 2
2: 21
3: 235
4: 1795
1002522618_1002522625 -1 Left 1002522618 5:179800050-179800072 CCACGATGTCATCCTCCAGCTGC 0: 1
1: 0
2: 1
3: 15
4: 188
Right 1002522625 5:179800072-179800094 CGAGGTGAGCAGAGAGGGGCTGG 0: 1
1: 0
2: 3
3: 56
4: 517
1002522618_1002522622 -7 Left 1002522618 5:179800050-179800072 CCACGATGTCATCCTCCAGCTGC 0: 1
1: 0
2: 1
3: 15
4: 188
Right 1002522622 5:179800066-179800088 CAGCTGCGAGGTGAGCAGAGAGG 0: 1
1: 0
2: 0
3: 31
4: 341
1002522618_1002522627 1 Left 1002522618 5:179800050-179800072 CCACGATGTCATCCTCCAGCTGC 0: 1
1: 0
2: 1
3: 15
4: 188
Right 1002522627 5:179800074-179800096 AGGTGAGCAGAGAGGGGCTGGGG 0: 1
1: 2
2: 11
3: 130
4: 889
1002522618_1002522628 7 Left 1002522618 5:179800050-179800072 CCACGATGTCATCCTCCAGCTGC 0: 1
1: 0
2: 1
3: 15
4: 188
Right 1002522628 5:179800080-179800102 GCAGAGAGGGGCTGGGGCTGAGG 0: 1
1: 1
2: 24
3: 228
4: 1690
1002522618_1002522629 11 Left 1002522618 5:179800050-179800072 CCACGATGTCATCCTCCAGCTGC 0: 1
1: 0
2: 1
3: 15
4: 188
Right 1002522629 5:179800084-179800106 AGAGGGGCTGGGGCTGAGGAAGG 0: 1
1: 3
2: 29
3: 201
4: 1652

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002522618 Original CRISPR GCAGCTGGAGGATGACATCG TGG (reversed) Exonic
900322694 1:2092971-2092993 ACACCTGGAAGCTGACATCGTGG - Intronic
900885314 1:5410942-5410964 GCAGCTGGAGGTTGAGAGCCGGG - Intergenic
901899425 1:12346045-12346067 GCAGGTGGAGGCTGACATCCTGG + Intronic
901947643 1:12716311-12716333 GCAGCTGGAAGATGCAATGGAGG - Exonic
902629283 1:17695222-17695244 GCAGCAGGACGATGACACCCTGG - Exonic
903570113 1:24297958-24297980 GCAGCTGGAGGAGGAGAAGGAGG + Intergenic
904897350 1:33826842-33826864 CCAGCTGGAAGATGGCACCGTGG - Intronic
905112154 1:35603555-35603577 GCAGCTGGAGGATGACTGGGAGG + Intronic
913969800 1:143406082-143406104 GCAGCTGGAGGAAGAGCTCAGGG + Intergenic
914064173 1:144231677-144231699 GCAGCTGGAGGAAGAGCTCAGGG + Intergenic
914114977 1:144734677-144734699 GCAGCTGGAGGAAGAGCTCAGGG - Intergenic
915013140 1:152708487-152708509 GTAGGAGGAGGATGACATGGTGG + Intronic
915682965 1:157599758-157599780 GCAGCTGAAAGATGACAGCACGG - Intergenic
917442173 1:175077757-175077779 GAAGCTGGAGGAAGAGATGGTGG + Exonic
918276702 1:182959754-182959776 GCAGCTGGAGACAGAGATCGAGG - Intergenic
921584189 1:216928593-216928615 GCAGCTGGAGGATTTAATCAGGG - Intronic
923037135 1:230292199-230292221 GCAGCAGGAAGAGGACATGGTGG - Intergenic
924718128 1:246597661-246597683 CCAGCTGAAGGATGACAAGGAGG + Intronic
1063244325 10:4202761-4202783 GCAGCTCGAGGAGGACAGCCTGG - Intergenic
1064245990 10:13668042-13668064 CAAGCTGGAGGATGCCATCAAGG + Intronic
1066451409 10:35533439-35533461 GCAGCTGCAGCATGACACTGAGG - Intronic
1067208504 10:44239534-44239556 GCAGCTGGAAGATGAGATGGAGG + Intergenic
1073403562 10:103277667-103277689 GCAGCTGGAGGAGGCCAGCTCGG + Exonic
1075263436 10:120981639-120981661 GCAACTGGGGGATGCCACCGTGG - Intergenic
1075843333 10:125523656-125523678 GCAGGAGGAGGATGACAGTGGGG - Intergenic
1077842933 11:5994551-5994573 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1078474797 11:11621422-11621444 GAAGCTGGAGGAAGACAAAGGGG - Exonic
1079217056 11:18523124-18523146 GAAGCTAGAGGATCACATTGAGG - Intronic
1080612276 11:33914956-33914978 TCAGATGGAGGATGAAATGGAGG - Intergenic
1081223617 11:40493990-40494012 GTAGCAGGAAGATGACATCAGGG + Intronic
1083556297 11:63631312-63631334 GGAGCTGGAGGAGGAAATCAAGG - Exonic
1089619715 11:119715129-119715151 GCAGCTGGAGGATGACCAACAGG + Intronic
1090627729 11:128620616-128620638 GCAGCTGGAGGCTGAGCTGGAGG - Intergenic
1090675210 11:128986019-128986041 GGAGCTGCTGGATGACATCGTGG + Exonic
1091092566 11:132786083-132786105 GCAGCTGGAGGTGGAAAGCGGGG - Intronic
1091602228 12:1924932-1924954 GGAGCTGGGGGAGGACTTCGTGG + Intergenic
1091695865 12:2627700-2627722 GCAGCTGGAGGCTGCCACGGTGG - Intronic
1092518396 12:9240178-9240200 GGAGCCGGAGGCTGACAACGAGG - Intergenic
1092796086 12:12111294-12111316 GGAGCCGGAGGCTGACAACGAGG + Intronic
1096634715 12:52950840-52950862 GCAGCTGGAGACAGAGATCGAGG + Exonic
1099115882 12:78623457-78623479 TCAGCTGGAGGAGGACTTCTGGG - Intergenic
1100437087 12:94581689-94581711 TCAGCTGGCTGAGGACATCGAGG - Exonic
1103878439 12:124147447-124147469 GCAGCTCAATTATGACATCGAGG - Intronic
1105247984 13:18669868-18669890 TCAGCTGGTGGATGATATCTGGG - Intergenic
1106110301 13:26771324-26771346 GCAGCTGGAGGAAGCCAGCAGGG - Intergenic
1109994633 13:70107754-70107776 GCAGGTGGGGGAGGACAGCGGGG + Exonic
1113397051 13:109957675-109957697 GGAGCTAGAGGATCACATCCAGG + Intergenic
1114548960 14:23522471-23522493 GCGGCTGGAGGAGGGCATTGGGG + Exonic
1119200167 14:72746362-72746384 GCAGCTGCAGGCTGGCATGGTGG + Intronic
1121473878 14:94175784-94175806 GCAGCTTGAAAATCACATCGTGG - Intronic
1122386279 14:101350468-101350490 GCAGCAGGAGGGTGGCATCTGGG - Intergenic
1124465855 15:29939386-29939408 GCAGCTGGAGGTGGAAATGGAGG - Intronic
1125745933 15:41997132-41997154 GCAGCTGGAGGAAGACCTGCAGG - Exonic
1125922117 15:43531156-43531178 TCAGCTGCAGGATGGCATAGTGG - Exonic
1127867480 15:63043702-63043724 CCAGCTCGAGGAGGACATCGCGG + Intronic
1134628507 16:15740083-15740105 GAAACTGGAGGATGAGATCCTGG - Exonic
1134779664 16:16884305-16884327 CCAGCTGGAGAAAGACATCTTGG - Intergenic
1136247820 16:28985414-28985436 GCAGATGGAGGAGGCCATCCTGG + Exonic
1141000233 16:80300876-80300898 GCAGCAGGAGGATGAGAAAGAGG - Intergenic
1141605841 16:85152802-85152824 GCAGCCGGAGGATGACAGCTGGG + Intergenic
1141995111 16:87631942-87631964 GCAGGTGGGAGAAGACATCGAGG - Intronic
1143108481 17:4541048-4541070 GCAGCTGGAGGTGGCCATCTGGG - Intronic
1143161459 17:4874492-4874514 GCAGCAGAAGGAAGACATGGGGG + Intronic
1143496970 17:7317980-7318002 GCAGCTGGAGGGTGCCACTGTGG - Intronic
1143929000 17:10400746-10400768 GGAGCTGGGGGAAGAAATCGAGG - Exonic
1143933150 17:10452297-10452319 GGAGCTGGAGGAGGAAATCGAGG - Exonic
1143937444 17:10501466-10501488 GGAGCTGGAGGAGGAAATCGAGG - Exonic
1143939856 17:10529046-10529068 GGAGCTGGAGGAGGAAATCGAGG - Exonic
1143951425 17:10635734-10635756 GCAGCTGGAGGAAGAGAACAAGG - Exonic
1144453270 17:15398688-15398710 GCAGATGGAGGAGGAAATGGTGG + Intergenic
1144873103 17:18382551-18382573 GGAGCTGGAGGAACAGATCGCGG + Exonic
1146339718 17:32008068-32008090 GGAGCTGGAAGATGACGACGAGG + Intronic
1146790936 17:35750175-35750197 GCAGCTGGAGGAGGAGATCGAGG - Exonic
1147365322 17:39955099-39955121 GGACCTGGGGGATGACAACGAGG + Intergenic
1149576349 17:57716207-57716229 GGAGCTGGAGGATGGGATTGGGG - Intergenic
1150101810 17:62430656-62430678 GCAGCTGGACGATAACAACTAGG - Intronic
1151230263 17:72679686-72679708 GCAGGTGGAGGATGGCCTGGTGG + Intronic
1154440869 18:14389260-14389282 TCAGCTGGTGGATGATATCTGGG + Intergenic
1157322728 18:46646899-46646921 GGAGCTGGAGGATGGCCTGGGGG - Intronic
1157710627 18:49847406-49847428 GCAGGTGGAGGATGGCACCTGGG + Intronic
1160793183 19:932439-932461 GGAGATGGAGGAAGACCTCGGGG + Exonic
1162001704 19:7748518-7748540 GCAGGTGGAGATTGACAACGGGG + Intergenic
1162078710 19:8206090-8206112 GAAGCTGGAGGAAGACACCTGGG - Intronic
1162334708 19:10053146-10053168 ACAGCTGGGGGATGACGTTGGGG - Intergenic
1164468667 19:28510013-28510035 GCAGATGGAAAATTACATCGGGG + Intergenic
1164796764 19:31039956-31039978 ACAGCTGAAGGCTGACATCTGGG - Intergenic
1167018292 19:46856236-46856258 GCAGCTGGAGGATTGCCGCGGGG - Intergenic
1168337803 19:55606045-55606067 GCATCTGGAGGCTGACCTGGAGG - Intronic
1168685612 19:58347530-58347552 GCAGCTCGAAGGTGACGTCGGGG + Exonic
925361004 2:3280360-3280382 GCACCTGGAGGATGGGAACGAGG - Intronic
929995810 2:46825714-46825736 GCAGCCAGAGGGTGACACCGTGG - Intronic
932759534 2:74430316-74430338 GCAGCTGGGGGAACACATCCAGG - Exonic
934174493 2:89566994-89567016 GCAGCTGGAGGAAGAGCTCAGGG + Intergenic
934284809 2:91641344-91641366 GCAGCTGGAGGAAGAGCTCAGGG + Intergenic
939365515 2:141225328-141225350 GCAGCTGGGGGATGACAATATGG + Intronic
941125693 2:161580658-161580680 GCAGCTGGAGGCAGAGATCAAGG + Intronic
943548660 2:189311928-189311950 GCAGCTGGAGACAGAGATCGAGG - Intergenic
947565254 2:231189441-231189463 GCATCTGGAGGCTGACACCTTGG - Intergenic
947945194 2:234095389-234095411 TCAGCAGGAGGATCACATCTTGG - Intergenic
948062749 2:235053654-235053676 GCAGCTCCTGGATGACATCCCGG - Exonic
948227581 2:236323441-236323463 TCAGGAGGAGGATGACTTCGTGG + Intergenic
948963749 2:241360010-241360032 GCAGCTGGAGGGAGACAGGGAGG - Intronic
1168916346 20:1491330-1491352 GCAGGTGGGGGCCGACATCGTGG + Exonic
1171114735 20:22515484-22515506 GAGCCTGGGGGATGACATCGGGG + Intergenic
1173135203 20:40433293-40433315 GCAGTTGGAGGCTGCCATAGGGG + Intergenic
1174349587 20:49957333-49957355 GCAGCTGGAGACAGAGATCGAGG + Intergenic
1175197387 20:57253659-57253681 GCAGCTGGTGGATGAGCTCATGG + Intronic
1176187643 20:63789884-63789906 GCAGGTGGAAGATGACAGCCGGG - Exonic
1176455184 21:6901924-6901946 TCAGCTGGTGGATGATATCTGGG - Intergenic
1176833356 21:13766972-13766994 TCAGCTGGTGGATGATATCTGGG - Intergenic
1179903013 21:44403424-44403446 GCAGCTGGCGCCTGACATTGAGG + Intronic
1181237621 22:21457171-21457193 GCTGCTGGAGGAAGACAAGGTGG + Intergenic
951231410 3:20183691-20183713 TCAGCTGTAGGATGATATCTTGG + Exonic
951550267 3:23870239-23870261 ACAGCTGCAGGATGAGATGGGGG + Intronic
952319142 3:32259528-32259550 GCAGCTGGAGACAGAGATCGAGG + Intronic
954106067 3:48410420-48410442 GGAGCTGGAGGAGGGCATGGTGG - Intronic
954410160 3:50367071-50367093 GGAGCTGGAGAATGACACTGTGG - Exonic
954799057 3:53176446-53176468 GGAGCTGGAGGAAGTCATCTGGG + Intronic
957590162 3:82186262-82186284 GCAGCTGGACGATGACAGGGAGG - Intergenic
960973468 3:123155391-123155413 TCAACTGGAGGATGCCATGGTGG + Intronic
962059005 3:131905287-131905309 GCATCTTGAGGATGACACAGGGG + Exonic
962340308 3:134576740-134576762 GCAGCTGTAGGAAGGCATCAGGG + Intergenic
962754266 3:138456295-138456317 TCAACTGGTGGATGACAACGTGG + Intronic
967189514 3:186973397-186973419 GCAGGAGGAGGATGACACAGGGG + Intronic
967635834 3:191801797-191801819 GCAGTAGCAGGATGACATCATGG - Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969475517 4:7420533-7420555 GCAGCTGGAGGCAGACCTCATGG + Intronic
969697182 4:8741369-8741391 GCTGCTGGAGGATGAATCCGTGG - Intergenic
972370297 4:38417071-38417093 GGAGCAGGAGGAAGACAGCGAGG + Intergenic
972538722 4:40020830-40020852 GCAGCTGGAGACAGAGATCGAGG + Intergenic
977891808 4:102321040-102321062 AAAGCTGGAGGATGACAACCAGG + Intronic
977959389 4:103068579-103068601 GCAACTGGAAGATGTCATCAAGG - Intronic
979851899 4:125581935-125581957 GCAGGTGGAGGATGATATCCTGG + Intergenic
980488752 4:133496843-133496865 GGAGCAGGAGGCTGACTTCGGGG - Intergenic
984807896 4:183768224-183768246 GCAGGTGGAGGAGGATATCAGGG + Intergenic
985262457 4:188127787-188127809 GCAGCTGGAGGCTGGCACCCGGG - Intergenic
987068819 5:14316623-14316645 GCACCTCGTGGATGACATCCAGG - Exonic
987286712 5:16465068-16465090 GCAGCAGGAGGAGGACAGCGAGG - Exonic
990552702 5:56899947-56899969 GAGGATGGAGAATGACATCGAGG + Intergenic
993859108 5:93112909-93112931 ACATCTGGAGGATGAAATCCTGG - Intergenic
996338775 5:122413221-122413243 GAAGCTGGGGGATGTCATCAGGG - Intronic
996452057 5:123636697-123636719 GCAGCTGGAGACAGAGATCGAGG + Intergenic
996789526 5:127277798-127277820 GCAGCTCAAGGATGACACCAAGG + Intergenic
998875674 5:146596659-146596681 GCAGCTGGAAGAGGACACTGAGG + Intronic
1000610409 5:163367478-163367500 GCAGCTGGAGGATCACAGATGGG + Intergenic
1001067087 5:168544139-168544161 GGAGCTGGAGGAAGACAGGGAGG - Intergenic
1001491209 5:172156704-172156726 GGAGCTGGAGGACTACATCGTGG - Exonic
1002437387 5:179239927-179239949 GCAGCAGCATGATGACCTCGGGG + Intronic
1002522618 5:179800050-179800072 GCAGCTGGAGGATGACATCGTGG - Exonic
1005761213 6:28969810-28969832 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1005816067 6:29553824-29553846 GCAGCAGCAGGATGACCACGCGG - Intergenic
1005951360 6:30633756-30633778 GGAGCAGGAGGCTGACAACGAGG + Intronic
1006580449 6:35074121-35074143 GCACCTGAAGGCTGACAGCGAGG - Intronic
1006609620 6:35286353-35286375 GCAGCTGGAAGATGGCAGCATGG + Exonic
1008125876 6:47667691-47667713 CCTGCTGGAAGATGACATCTTGG + Intronic
1009250029 6:61287530-61287552 GCAGCTGGAACATGACATTAAGG + Intergenic
1009311108 6:62153908-62153930 GCAGGTGGTGGATAACATAGTGG - Intronic
1009517829 6:64642091-64642113 GCAGCTTGATGATGCCATCAAGG - Intronic
1011546805 6:88490588-88490610 TGAGCTGGAGGATGACCTGGTGG + Intergenic
1012981090 6:105831111-105831133 GCAGCTGGAGGAGGAGAAGGGGG + Intergenic
1013667332 6:112362117-112362139 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1013836775 6:114343096-114343118 GCAGCTGGAGGAGGAGCACGGGG - Intergenic
1014009241 6:116457997-116458019 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1015454174 6:133406327-133406349 ACAGCTAGAGAATGACATCTGGG + Intronic
1015966117 6:138696639-138696661 GCTGTGGGAGGGTGACATCGGGG - Intergenic
1018074413 6:160198808-160198830 GCAGCTGGTGGATAACATTCTGG + Intronic
1019613980 7:1950625-1950647 GCAGCTGGGGGCAGACATTGAGG - Intronic
1020076383 7:5261631-5261653 GCAGCTGGTGGATAAATTCGGGG - Intergenic
1022311647 7:29201942-29201964 ACAGCTGGAGGATGATATTGGGG + Intronic
1022772362 7:33487635-33487657 GCTGCTGGAGGAAGAGATCTGGG + Intronic
1023118069 7:36882150-36882172 GCAGCTGGGGGCTGACCCCGGGG + Intronic
1025144307 7:56491612-56491634 GCAGCAGGAGGAGGACCTCCTGG - Intergenic
1026827966 7:73595861-73595883 GCAGCTGCGGGATGAGATTGAGG - Exonic
1026833559 7:73624017-73624039 GCCGCTGTAGGAGGACCTCGGGG + Intronic
1032030956 7:128483519-128483541 GCAGCTGGACGATAACAACTAGG - Intronic
1032097768 7:128947955-128947977 GTAGCTGGAGGATGAGCCCGCGG - Exonic
1033265827 7:139886220-139886242 GCAGCTTGAGGGTGAGATGGAGG - Intronic
1034090366 7:148358318-148358340 CCAGGTGGAGGATGAAATGGGGG + Intronic
1034282032 7:149861296-149861318 GCAGCTGCGGGATGACCTCCTGG - Exonic
1034353575 7:150433184-150433206 GCAGCTGGAGGATGGCCAGGTGG + Intergenic
1035708872 8:1697365-1697387 GCAGATAGAGCATGACAACGGGG + Intronic
1037666209 8:20972391-20972413 CCAGCTGGAGAATAACATCAAGG + Intergenic
1038625930 8:29193204-29193226 GCAGCTGGATGATGTCTTCTGGG - Intronic
1040066026 8:43144584-43144606 GGACCTGGAGTATGACATAGTGG - Intronic
1040461396 8:47652415-47652437 GCAGCAGGAGGATGTCAGCTGGG + Intronic
1041258718 8:56001574-56001596 GCAGCTGGAAGATGAAATGCTGG - Intronic
1044631246 8:94280653-94280675 TCAGCTGGAGGATGACACCTGGG + Intergenic
1045906118 8:107347079-107347101 GCAGCTTGAGAATTACATTGTGG - Exonic
1049682146 8:143924144-143924166 GCAGGTGGAGGAGGAGATCCTGG - Exonic
1051061984 9:13055413-13055435 GCAGCTGGGGAATGATATTGAGG + Intergenic
1060348610 9:122838134-122838156 GCAGCTGGAGACAGAGATCGAGG + Intergenic
1061081164 9:128371241-128371263 GCTGTTGGAGGAAGTCATCGAGG - Intergenic
1061967545 9:134024928-134024950 GGAGCTGGAGGAAGACGTGGAGG - Intergenic
1203776191 EBV:74509-74531 GCCGCGAGAGGATGGCATCGAGG + Intergenic
1190628721 X:52364273-52364295 GCAGCTGCAGAAAGACATGGTGG + Intergenic
1191690483 X:63933578-63933600 GAAGTTTGAGGATGCCATCGAGG - Intergenic
1195497400 X:105552608-105552630 GCAGATGGAGGAAGACAGAGAGG - Intronic
1197617897 X:128715093-128715115 GCAGCTGGAGACAGAGATCGAGG + Intergenic
1198951076 X:142073179-142073201 GCATTTGGAGGATGAGATGGAGG - Intergenic
1199850631 X:151722953-151722975 GAAGCTGGAGGAGGACTGCGTGG + Exonic
1200085876 X:153604737-153604759 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1200144826 X:153921120-153921142 GCAGCTGCAGGATGAGCTCCTGG - Exonic
1200831071 Y:7689335-7689357 GCAGGTGGCGGATGACATAATGG - Intergenic
1200951470 Y:8903140-8903162 GCTACTGGTGGATGACATCACGG - Intergenic
1201048167 Y:9907926-9907948 GCAGCTGTTGGATGACATAATGG - Intergenic