ID: 1002523094

View in Genome Browser
Species Human (GRCh38)
Location 5:179802024-179802046
Sequence TGTGCGCTGGCACACTGGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002523094 Original CRISPR TGTGCGCTGGCACACTGGAG GGG (reversed) Exonic
900492793 1:2960992-2961014 TGCATGCTGGCACACAGGAGAGG + Intergenic
901122723 1:6908223-6908245 TGTGCCTTGGCACCCTGGAGGGG - Intronic
902482444 1:16718913-16718935 TGGGCCCAGGCACACTGGCGTGG - Intergenic
903667439 1:25016687-25016709 TGGGCCCTGGCACACAGTAGGGG - Intergenic
905108262 1:35576833-35576855 GGCGCGCTGGCTCCCTGGAGCGG + Intronic
906702558 1:47870564-47870586 TGTGTGCTGGAAAACAGGAGGGG - Intronic
916368538 1:164061745-164061767 TGTGCCCTGGCAAAATGGTGGGG - Intergenic
917267364 1:173235429-173235451 TGTGCACTGGGACAATGGGGTGG - Intergenic
920212143 1:204335940-204335962 TGTGCCCTGGAACACTTTAGAGG - Intronic
921606974 1:217167302-217167324 AGTGCACTGACACAATGGAGTGG + Intergenic
1067414623 10:46094126-46094148 CGTGAGCTGGAACACAGGAGGGG + Intergenic
1067439048 10:46297985-46298007 CGTGAGCTGGAACACAGGAGGGG - Exonic
1067581298 10:47447712-47447734 TGTGAGCTGGAACACAGGAGGGG - Intergenic
1071292671 10:84198669-84198691 TGTGCGCTGGTGCAGTGCAGGGG + Intronic
1071466184 10:85941972-85941994 TGTGCAGTGGGGCACTGGAGGGG + Intronic
1076686327 10:132199971-132199993 TGTGAGCTGGAACCCTGGTGAGG + Intronic
1076836164 10:133022092-133022114 GGTGCCCTGAGACACTGGAGGGG - Intergenic
1081851523 11:46278009-46278031 TGAGCGCTGGCAAACGGGCGGGG - Exonic
1083879166 11:65539805-65539827 TGTGCGCTGGCCCCCTGGCCGGG - Exonic
1084796136 11:71505718-71505740 TGTTCTCTGGCAGACAGGAGTGG - Intronic
1084826773 11:71737737-71737759 TGTTCTCTGGCAGACAGGAGTGG - Intergenic
1085754721 11:79193013-79193035 TGGGCGCTGGGAGGCTGGAGAGG - Intronic
1087844810 11:102961099-102961121 TGAGGGCTGGATCACTGGAGAGG - Intergenic
1093327999 12:17803362-17803384 TGTGCCCTGGGACACAGGTGAGG + Intergenic
1096135729 12:49198740-49198762 TTTGCTCTGGTACATTGGAGTGG + Intronic
1096879120 12:54653297-54653319 TGTGCGCACGCACATTTGAGTGG + Intergenic
1101453957 12:104809870-104809892 TGTGGCCTGGCTCACTGGGGGGG - Intronic
1104540644 12:129661242-129661264 TGGACGCAGGCATACTGGAGTGG + Intronic
1106413140 13:29524814-29524836 TGGGCACTGGCCCACGGGAGGGG + Intronic
1107990732 13:45816746-45816768 TCTGAGCTGTCACACTGGATTGG - Intronic
1109638936 13:65161439-65161461 TGTGCACTGGAAGAATGGAGTGG - Intergenic
1110773481 13:79377976-79377998 TGTGCCATGGCACACTGGTTGGG - Intronic
1117797288 14:59407492-59407514 TGTCCTTTGGCAAACTGGAGTGG - Intergenic
1123017666 14:105383105-105383127 GGTGTCCTGCCACACTGGAGTGG + Intronic
1123188555 14:106544353-106544375 GGTGCTCTGGGACATTGGAGGGG + Intergenic
1124119908 15:26880250-26880272 TGTGAGCTGGCACACTGAAGGGG + Intronic
1127843072 15:62847006-62847028 TGTGGGCTGGCACCTAGGAGGGG + Intergenic
1132335308 15:101044635-101044657 TGTGCGGTGGCACACAGAAGAGG - Intronic
1132519480 16:380918-380940 TGTGGCCTGGGACTCTGGAGGGG - Intronic
1134036610 16:11036154-11036176 TGTGCCCTGGCTGACTGGGGTGG - Intronic
1137574020 16:49586578-49586600 TCGGAGCTGGCACACTGGCGGGG - Intronic
1138542274 16:57695702-57695724 TGTGCTCTGGGACTCAGGAGGGG - Intronic
1138596821 16:58033497-58033519 TGGCCCCTGGCACACAGGAGAGG - Intronic
1139311985 16:66035129-66035151 TGAGAGCTGGAACAGTGGAGGGG + Intergenic
1143380794 17:6495173-6495195 TGTGCGCTGGAAGACAGGAGAGG + Intronic
1145695291 17:26782432-26782454 TGTGGGCAGGGATACTGGAGTGG + Intergenic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1150311428 17:64131788-64131810 TGTCAGCTGGCAAACTGGACAGG - Intergenic
1151868931 17:76823437-76823459 TGTGCACAGGCACCCAGGAGAGG - Intergenic
1151876913 17:76872067-76872089 TGTGTGCTGTCACACTGGGTGGG - Intronic
1156939179 18:42744105-42744127 TGTTCTCTGGCAGACAGGAGTGG - Intronic
1160765261 19:804749-804771 TGGGCACAGGCACACGGGAGGGG + Intronic
1161098871 19:2410354-2410376 TGTGCGCTGGCTACCTGGACGGG + Exonic
1168434848 19:56308670-56308692 TGTGCAATGGCATAATGGAGCGG - Intronic
925917299 2:8615776-8615798 AGCAGGCTGGCACACTGGAGAGG - Intergenic
926125923 2:10271866-10271888 TGTGCGCTCAGACAGTGGAGGGG + Intergenic
926973680 2:18491891-18491913 TGTGCGCTGACTTACAGGAGAGG + Intergenic
929993098 2:46805894-46805916 TGTGCCCTGACACACTGGTGGGG + Intergenic
935133084 2:100275743-100275765 AGTGCCCAGGCACACTGGTGGGG - Exonic
936006875 2:108896952-108896974 TGTGTGCAGACATACTGGAGTGG - Exonic
936071710 2:109375623-109375645 TCTGCCCTGGCCCACTGGGGAGG - Intronic
937265399 2:120612027-120612049 TTTGGGCTGGAGCACTGGAGAGG - Intergenic
942277348 2:174332922-174332944 TGTGCCCTGGGAGACTGTAGTGG - Intergenic
942847361 2:180442751-180442773 TGTGAGGTAGCCCACTGGAGAGG + Intergenic
948714676 2:239853327-239853349 TGTGTGCTGGTGGACTGGAGCGG - Intergenic
948719537 2:239889975-239889997 TGTTGGCTAGCACATTGGAGAGG - Intergenic
1170886531 20:20344259-20344281 TGTGCGATGGCACAGAAGAGTGG + Intronic
1172691590 20:36793993-36794015 TGCGCTCCGGCTCACTGGAGAGG - Exonic
1174164916 20:48577768-48577790 TGTGCACAGGCACATTGGTGGGG + Intergenic
1177102376 21:16914341-16914363 TGTTCTCTGGCAGGCTGGAGTGG - Intergenic
1177872791 21:26593613-26593635 TATGAGCTGGCACTCTGTAGAGG + Intergenic
1181602887 22:23962598-23962620 GGTGCGGTGGCACACTCGGGAGG + Intergenic
1181605627 22:23978709-23978731 GGTGCGGTGGCACACTCGGGAGG - Intronic
1181636204 22:24176001-24176023 TGTGCCCTGGGACACTGGGCAGG - Intronic
1183760192 22:39809532-39809554 ACTTCTCTGGCACACTGGAGAGG + Intronic
1184665006 22:45983698-45983720 TGGGGGCTGGCAGGCTGGAGGGG + Intergenic
1184887319 22:47354353-47354375 TCTCCCCTGGCAGACTGGAGTGG + Intergenic
1184958308 22:47908430-47908452 TGTGGGCTGGCAAGATGGAGTGG + Intergenic
949162429 3:896178-896200 TGTTCTCTGGCAGACAGGAGTGG + Intergenic
954002872 3:47571557-47571579 AGTGCACAGGCACAATGGAGAGG + Intronic
961622668 3:128236989-128237011 TGGTGGCTGGCACACTTGAGAGG - Intronic
968231910 3:197009422-197009444 TGTGATCTAACACACTGGAGGGG + Intronic
982269133 4:153568944-153568966 TTTGGGGTGGCCCACTGGAGGGG + Intronic
985319442 4:188693314-188693336 TGTGCCCTGGTACACTGAAGGGG + Intergenic
995853218 5:116568680-116568702 TGTGCTCTTGGACACAGGAGGGG + Intronic
998849854 5:146342282-146342304 TGTTCGCTGGGACACTCTAGTGG + Intergenic
1001743792 5:174074485-174074507 TGGGAGCTGGCACAGTGGAAAGG - Intronic
1002523094 5:179802024-179802046 TGTGCGCTGGCACACTGGAGGGG - Exonic
1003488394 6:6599474-6599496 TGTGGGGTGAGACACTGGAGTGG + Intronic
1004971283 6:20913421-20913443 TGTGAGCTGCCATATTGGAGAGG - Intronic
1005463628 6:26091416-26091438 TCTGCCCTGACACACTGGATTGG + Exonic
1008617465 6:53240441-53240463 TTCACACTGGCACACTGGAGAGG + Intergenic
1016753495 6:147658182-147658204 ACTGGGCTGGGACACTGGAGAGG - Intronic
1017239179 6:152148011-152148033 TTTAAGCTGGCAAACTGGAGAGG + Intronic
1017779698 6:157706262-157706284 TGTTCTCTGGCACGCAGGAGTGG + Intronic
1018647345 6:165960884-165960906 TCTGCGCTGGCCCCCAGGAGTGG + Intronic
1022132406 7:27416620-27416642 CCTGCCCTGGCACACGGGAGTGG - Intergenic
1024266613 7:47611596-47611618 AGTGCCCTGGCTCACAGGAGTGG - Intergenic
1026571566 7:71535944-71535966 TGTGTACTGTAACACTGGAGCGG + Intronic
1026796267 7:73367988-73368010 TGTGACCTGGCACACTCCAGGGG - Intergenic
1027303758 7:76870056-76870078 TGTGTGCTGGCATACAGGATTGG - Intergenic
1029666230 7:101996885-101996907 TGTGGGCAGGAATACTGGAGGGG - Intronic
1030113272 7:106044249-106044271 TGTGGGCTGGCACTCCTGAGAGG + Intergenic
1032625761 7:133590133-133590155 TGTGCACTGGGAAAATGGAGTGG - Intronic
1032958490 7:137001621-137001643 TTGGCCGTGGCACACTGGAGAGG + Intronic
1033823328 7:145160106-145160128 TGTGCTATGGCACCCTGGTGTGG - Intergenic
1037925987 8:22844729-22844751 TGTGCCCTGGCCCACTGGCCGGG + Intronic
1038270801 8:26073978-26074000 TTTCAGATGGCACACTGGAGGGG - Intergenic
1045136053 8:99219637-99219659 TGTGTGCACGCACACTGGTGAGG + Intronic
1048775925 8:137946396-137946418 TGTGCTATGGCACAGTGAAGAGG + Intergenic
1054826328 9:69577440-69577462 TGTGTGCTGGTGTACTGGAGTGG - Intronic
1056963532 9:91147256-91147278 TGAGCTCAGGCACACTTGAGGGG - Intergenic
1058967080 9:110048586-110048608 TGGGCGCTGGGCTACTGGAGGGG + Exonic
1059215964 9:112562425-112562447 TGTGAGCTGGGACAGTGCAGGGG - Intronic
1059388996 9:113987073-113987095 TCTCCTCTGGCACAGTGGAGAGG + Intronic
1060204469 9:121674426-121674448 TGTGGGCTGGGAGACTGGAGAGG + Intronic
1060991130 9:127849746-127849768 AGTGTGCTGCCACAGTGGAGAGG - Intronic
1062270081 9:135704327-135704349 TTTGAGCTGGGGCACTGGAGTGG - Intronic
1062723667 9:138058904-138058926 TGTGGGCTGGGACAGTGGGGAGG + Intronic
1187575304 X:20547660-20547682 TGAGTGCTGGCAGAATGGAGTGG + Intergenic
1189555879 X:42144847-42144869 TGTGTGCTGAGACACAGGAGAGG - Intergenic
1194823124 X:98529796-98529818 TGTTCTCTGGCGCACAGGAGTGG + Intergenic
1201309883 Y:12587410-12587432 TGTGCACTGGGAGAATGGAGTGG + Intergenic
1202075915 Y:21037870-21037892 TGTTCTCTGGCAGACAGGAGTGG - Intergenic
1202100649 Y:21304016-21304038 AGTGCACTGGCAGACTGAAGGGG + Intergenic