ID: 1002523295

View in Genome Browser
Species Human (GRCh38)
Location 5:179803056-179803078
Sequence GGCAAAGTTCAGTCACCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 113}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002523291_1002523295 4 Left 1002523291 5:179803029-179803051 CCCTGTGCATGATCAAGGTCATG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1002523295 5:179803056-179803078 GGCAAAGTTCAGTCACCTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 113
1002523285_1002523295 21 Left 1002523285 5:179803012-179803034 CCTCACCCCACCAGCAGCCCTGT 0: 1
1: 1
2: 7
3: 125
4: 1546
Right 1002523295 5:179803056-179803078 GGCAAAGTTCAGTCACCTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 113
1002523287_1002523295 15 Left 1002523287 5:179803018-179803040 CCCACCAGCAGCCCTGTGCATGA 0: 1
1: 0
2: 3
3: 23
4: 311
Right 1002523295 5:179803056-179803078 GGCAAAGTTCAGTCACCTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 113
1002523292_1002523295 3 Left 1002523292 5:179803030-179803052 CCTGTGCATGATCAAGGTCATGA 0: 1
1: 0
2: 0
3: 16
4: 101
Right 1002523295 5:179803056-179803078 GGCAAAGTTCAGTCACCTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 113
1002523289_1002523295 11 Left 1002523289 5:179803022-179803044 CCAGCAGCCCTGTGCATGATCAA 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1002523295 5:179803056-179803078 GGCAAAGTTCAGTCACCTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 113
1002523286_1002523295 16 Left 1002523286 5:179803017-179803039 CCCCACCAGCAGCCCTGTGCATG 0: 1
1: 0
2: 1
3: 30
4: 306
Right 1002523295 5:179803056-179803078 GGCAAAGTTCAGTCACCTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 113
1002523288_1002523295 14 Left 1002523288 5:179803019-179803041 CCACCAGCAGCCCTGTGCATGAT 0: 1
1: 0
2: 2
3: 18
4: 207
Right 1002523295 5:179803056-179803078 GGCAAAGTTCAGTCACCTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002523295 Original CRISPR GGCAAAGTTCAGTCACCTCA GGG Intronic
900646724 1:3712438-3712460 GGCTAAGTTCTGTGACCTCCAGG - Intronic
901630543 1:10646041-10646063 GGCACAGGACAGTCACCTCCTGG - Intronic
902754281 1:18539022-18539044 GGGAAAGTTCCTTCACCTCCTGG + Intergenic
904605793 1:31696883-31696905 GGCAGACGTCAGTCAGCTCAGGG + Intronic
908187962 1:61670779-61670801 GGCACATTCCAGTCATCTCAAGG + Intergenic
908782987 1:67708684-67708706 GGCTAAGTTCATTCTCATCAGGG + Intronic
910427794 1:87133100-87133122 GGCAGGATTCAGACACCTCAAGG - Intronic
912452766 1:109777350-109777372 GGCCCAATTCAGACACCTCATGG - Intergenic
921595811 1:217052629-217052651 AGCAATGTTCAGTCAAGTCAAGG - Intronic
923316725 1:232787520-232787542 GGCAAAATTAAGTGATCTCATGG + Intergenic
923357676 1:233176656-233176678 GGCAAACTGCAGCCACCTGAGGG + Intronic
923422559 1:233832745-233832767 GGCAAACTTTAGTCACCTGGGGG - Intergenic
1065424230 10:25582347-25582369 GCCAGAGTTCTGTCACCCCATGG + Intronic
1067041635 10:42956208-42956230 GGCACAGTTCAGTCAAGACAAGG - Intergenic
1067337454 10:45376708-45376730 GGCATAGTTCAGTCAAATAATGG + Intronic
1068931523 10:62595316-62595338 GACAAATTTCAGCCACTTCATGG - Intronic
1069868330 10:71517867-71517889 GGGAAAGGGCAGGCACCTCAGGG - Intronic
1070321505 10:75358269-75358291 GGCAAGGTCCAGGCAGCTCAGGG - Intergenic
1074484194 10:113856296-113856318 GGCAGAATTCAGTTATCTCATGG + Intronic
1075513129 10:123088205-123088227 GGTAAAATTCAGTCACATAATGG + Intergenic
1076379159 10:130013620-130013642 GGCAAAGTGCAGTCACAACGGGG + Intergenic
1078484161 11:11706317-11706339 GGCAAAGCTGATTCATCTCAGGG + Intergenic
1078880273 11:15441353-15441375 GGCAAAGTCCAGTAACCTTGAGG - Intergenic
1078929229 11:15900810-15900832 GGCCAAGTTGAGGCCCCTCAAGG - Intergenic
1079983803 11:27179176-27179198 AGCAAGGTTCAGAGACCTCAAGG - Intergenic
1080429840 11:32188248-32188270 GGAAAAGTTAAGTCACATAATGG - Intergenic
1080846269 11:36029827-36029849 TACAAAGTGCAGACACCTCATGG + Intronic
1081176600 11:39934364-39934386 GGCAAAGTTCACTCTCTTAAGGG + Intergenic
1083289057 11:61679982-61680004 AGCAGAGTTCAGTCACCCCGAGG + Intergenic
1086186144 11:84019312-84019334 GGCAGAGTTTTGTGACCTCAAGG + Intronic
1086915686 11:92527672-92527694 GGCAACCTTCAGCCAGCTCAAGG + Intronic
1090909760 11:131108444-131108466 GGGAAAGTTATGTAACCTCATGG - Intergenic
1092282563 12:7108891-7108913 GGCAAATTTCAGTCTCCCCATGG + Intronic
1094594667 12:31854243-31854265 GCCAAAGTTCAGGGGCCTCAGGG + Intergenic
1095842457 12:46708721-46708743 GGGAAACTTGAGTCATCTCATGG - Intergenic
1105996254 13:25674944-25674966 AGCAAATTTCAGTCACCAAAAGG + Intronic
1109781639 13:67118085-67118107 GGCAATGTTAAGTCATTTCAAGG + Intronic
1112952413 13:105016481-105016503 GACAAAGTTCACTTACCTCGAGG - Intergenic
1117742935 14:58836385-58836407 GGCGGAGTTCAGTTACCACAGGG + Intergenic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1128501674 15:68231052-68231074 GGCATAGCTCAGACCCCTCATGG - Intronic
1130128977 15:81120339-81120361 GGAACAATTCAGACACCTCAAGG + Intronic
1130313161 15:82772016-82772038 GGAACAGTTCAGGCCCCTCAGGG - Intronic
1130878988 15:88038788-88038810 GGCACAGCTCCGTCACCACAGGG - Intronic
1132017869 15:98334927-98334949 TCCAAAGTTCAGTCTTCTCAAGG - Intergenic
1132147357 15:99436708-99436730 AGAAAAGTTCCGTCACCTCGAGG - Intergenic
1141125203 16:81396231-81396253 GGCAAAGATCAGGAATCTCAAGG - Intergenic
1144374623 17:14626998-14627020 GGAAAAGTTCTCTCACATCATGG - Intergenic
1146419246 17:32667040-32667062 GGCAGAGTTCTGACACCTTACGG + Intronic
1146520304 17:33521082-33521104 GACAAGGTTCAATAACCTCAAGG + Intronic
1148478604 17:47945606-47945628 GGGAAAATTCACTCACCTGACGG - Exonic
1148519995 17:48264595-48264617 GGCAAAGTTCAGTATCTTTATGG - Intronic
1149990976 17:61383406-61383428 GGCACAGTGCTGTCTCCTCAGGG + Intronic
1151350488 17:73528943-73528965 GGCAGAGCTCAGGGACCTCAAGG - Intronic
1153484532 18:5583307-5583329 GGAGAAGTTCAGTGACCCCATGG + Intronic
1153495969 18:5700056-5700078 CACAACCTTCAGTCACCTCAGGG + Intergenic
1153904224 18:9646779-9646801 AGCCATGTTCAGTCACCTCCTGG + Intergenic
1163712246 19:18853783-18853805 GGGAATGTGCAGTGACCTCATGG + Intronic
1165977122 19:39685887-39685909 GACAATGTGTAGTCACCTCATGG - Intergenic
925773249 2:7305141-7305163 GGCAGAGCTCAGTCAACCCATGG - Intergenic
931605703 2:64050138-64050160 GGTCAAGTTCAGACACCACATGG + Intergenic
940007374 2:149020376-149020398 TGCTTAGTTTAGTCACCTCAAGG - Intronic
942070693 2:172312929-172312951 GGCAGACTTCAGGGACCTCATGG + Intergenic
945256644 2:207808693-207808715 GGCAAGGATCAGTCATGTCATGG + Intergenic
947010543 2:225561436-225561458 GGCAAGGGTTAGTCAACTCATGG + Intronic
1170475576 20:16710996-16711018 GTGAAAGTTCAGCCACCTCTGGG + Intergenic
1175421860 20:58839839-58839861 GGGAAAGTTCTGTCTCCTCCCGG - Intronic
1179526503 21:41980359-41980381 GGCAGAGCTCAGTGACCTGATGG - Intergenic
1180597971 22:16991659-16991681 GGCAAAGTGCAGAGAGCTCAGGG + Intronic
1180714547 22:17862823-17862845 GGCAAAGGCCAGTGAGCTCAGGG - Intronic
1182147754 22:28007303-28007325 GGCAAAGATCACACACCTCCTGG + Intronic
1182294045 22:29302763-29302785 GGCATAGATCAGTCTCCCCATGG - Intergenic
1185163104 22:49241359-49241381 TGCAAAGCTCAGTAACCTCCAGG - Intergenic
1185163122 22:49241438-49241460 TGCAAAGCTCAGTGACCTCCTGG - Intergenic
952327660 3:32335557-32335579 GGCCAAGGTCAGTAAACTCATGG - Intronic
953386517 3:42509350-42509372 GGCCATGTTCAATCCCCTCAAGG - Intronic
965953231 3:174335883-174335905 GGCAGAGTTTAGTTAGCTCAAGG + Intergenic
966643401 3:182215723-182215745 GGCAAAGTTGCTTCCCCTCAAGG + Intergenic
970881194 4:20933994-20934016 GGTAAAGTTATGTCACCTCAAGG + Intronic
979486196 4:121273325-121273347 GTCAAAGCTCAGTGACTTCAAGG + Intergenic
987902665 5:24032749-24032771 GGCAAAATTCAGTAACTTCCAGG + Intronic
990014071 5:51036792-51036814 GTCAAAGTTCATTAACTTCAGGG - Intergenic
990421281 5:55636957-55636979 GCCAGAGTTCAGTCACCCCTAGG + Intronic
992080066 5:73228188-73228210 GGCAAAGCTCAGTCCCTCCATGG + Intergenic
997064162 5:130543148-130543170 GGCAGAGTTCAGTAAGCCCATGG - Intergenic
1000387528 5:160688830-160688852 AGCACAGCCCAGTCACCTCATGG - Exonic
1002523295 5:179803056-179803078 GGCAAAGTTCAGTCACCTCAGGG + Intronic
1005625264 6:27656463-27656485 CTCAAAGTTCATTCACGTCATGG - Intergenic
1009283575 6:61782294-61782316 GGCCAAGTTATGTCACTTCATGG + Intronic
1014570992 6:123007325-123007347 AGAAAAGTTCAGTAACTTCAAGG + Intronic
1017250069 6:152270919-152270941 GGCAAATTTCTTTCACCTTAGGG - Intronic
1019873988 7:3792572-3792594 GGCAATATTCAGGCACCTGATGG - Intronic
1021194613 7:17661424-17661446 GGCAAAGTTCTCTCTCCTCTTGG - Intergenic
1021559955 7:21959833-21959855 GGCTAAGTTCAGTTAGGTCATGG - Intergenic
1027851235 7:83454518-83454540 GGCACATTTCAGTCACATAATGG + Intronic
1031678340 7:124638971-124638993 GCCAGAGTGCAGTCATCTCAAGG + Intergenic
1032575824 7:133053210-133053232 GGCCAGGCTCAGTCACGTCAGGG + Intronic
1033427657 7:141259843-141259865 CTCAAAGTTCAGTCAGCTTATGG + Intronic
1033932527 7:146541956-146541978 AGAAAATTCCAGTCACCTCAGGG + Intronic
1034598269 7:152220387-152220409 GGCAAGGGTCAGTCACATCAGGG + Intronic
1036072214 8:5453733-5453755 GGCACAGATATGTCACCTCATGG + Intergenic
1041575302 8:59387257-59387279 GGCAGGATTCAGTCCCCTCATGG - Intergenic
1041727352 8:61030544-61030566 GGCAAAGCTCAGTCTCCTTCAGG + Intergenic
1042340785 8:67676686-67676708 GGTAAAGTTCAGTCCTCTGAAGG - Intronic
1045328328 8:101134001-101134023 GGCAGAGCTCAGAAACCTCAGGG + Intergenic
1046623484 8:116552697-116552719 GGAAAAGTGCAGACAACTCAAGG + Intergenic
1048672147 8:136735134-136735156 GGCAAAGTGCAGCCAACTAAAGG + Intergenic
1056054660 9:82808478-82808500 GGCAAACTTGAGACACATCAAGG - Intergenic
1056580090 9:87884074-87884096 GGCAAAGCTCAGTTACCTCTGGG - Intronic
1057564081 9:96153026-96153048 GTCACAGATCAGTCACATCAGGG - Intergenic
1057625433 9:96672148-96672170 TGAAAAATTCAGTCACCACATGG - Intergenic
1059656814 9:116365121-116365143 GGCAAAGTGGATTCTCCTCAGGG - Intronic
1059740332 9:117143851-117143873 GCCAAAGTTCAATCAGATCAGGG + Intronic
1059823042 9:117995548-117995570 GGCAAAGTTCAATCAGCTATTGG + Intergenic
1062598008 9:137307730-137307752 GGCTGAGCACAGTCACCTCATGG + Intronic
1189243137 X:39541103-39541125 GGCATACCGCAGTCACCTCAGGG - Intergenic
1190512401 X:51186290-51186312 GACACAGTTCAGTCCACTCAGGG + Intergenic
1191869546 X:65734303-65734325 GGGGAAGTTCAGGCACCTCATGG - Intronic
1199492501 X:148416336-148416358 GGCAAAGTTCAGAAGCCGCAAGG - Intergenic