ID: 1002523475

View in Genome Browser
Species Human (GRCh38)
Location 5:179803753-179803775
Sequence CCGTGGGGCCCTTTATCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002523475_1002523488 24 Left 1002523475 5:179803753-179803775 CCAGGAGATAAAGGGCCCCACGG 0: 1
1: 0
2: 2
3: 13
4: 82
Right 1002523488 5:179803800-179803822 GTCATTTCCCTACACACTGCAGG No data
1002523475_1002523489 30 Left 1002523475 5:179803753-179803775 CCAGGAGATAAAGGGCCCCACGG 0: 1
1: 0
2: 2
3: 13
4: 82
Right 1002523489 5:179803806-179803828 TCCCTACACACTGCAGGCCCTGG 0: 1
1: 1
2: 2
3: 24
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002523475 Original CRISPR CCGTGGGGCCCTTTATCTCC TGG (reversed) Intronic
900158248 1:1212026-1212048 CCGGGGGGCCCTGGGTCTCCTGG + Exonic
900391113 1:2434361-2434383 CCGTGGGGCCCCTTCTCTCCCGG + Intronic
904603008 1:31683966-31683988 CCTGGGGGCCCTTGAACTCCTGG + Exonic
905307730 1:37031013-37031035 CCGTGGGGACCTGAATTTCCAGG - Intronic
907427019 1:54386343-54386365 CCGTGGGGCATTTTATCTGAAGG - Intronic
915612637 1:157006836-157006858 CACTGGGGCCCTTCATCTTCTGG - Intronic
922633420 1:227138499-227138521 TTCTGGGGCACTTTATCTCCTGG - Intronic
923655230 1:235910045-235910067 CCGTGAGTCCCTTCATCTCCAGG - Intergenic
1062999826 10:1906054-1906076 CAGTGTGGCCCTGTACCTCCTGG + Intergenic
1070759917 10:79017675-79017697 CTGGGGGGCCCTGCATCTCCTGG - Intergenic
1074061228 10:109967665-109967687 CCGAGGGCCTCTTTTTCTCCAGG + Intergenic
1076355477 10:129849703-129849725 CTGTGCGGACCTTTATCTCCGGG - Intronic
1077282567 11:1752336-1752358 ACCTGGGGCCATTTATTTCCCGG + Intronic
1077298258 11:1835978-1836000 CAGCGGGGCCCTTCACCTCCTGG - Exonic
1080614866 11:33937132-33937154 CTATGAGGCCCTTTATCACCGGG - Intergenic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1089147035 11:116336616-116336638 CCATGGAGCCATTTATCTCCTGG + Intergenic
1089252917 11:117178383-117178405 CCCTGGGCCACTTTTTCTCCGGG - Intergenic
1094843590 12:34351942-34351964 CCGTGGGGCCCAGTCACTCCGGG + Intergenic
1095916168 12:47481110-47481132 CCCTAGGGTCATTTATCTCCAGG - Intergenic
1100708614 12:97229044-97229066 CTGTGAGGCCCTTCATCACCTGG + Intergenic
1104038383 12:125114183-125114205 CCGTGGTGCCCTTGATGTCCTGG + Intronic
1104405275 12:128511656-128511678 CCTTGGGGTCCTGTCTCTCCTGG + Intronic
1111574786 13:90138486-90138508 CCATGGGGAGTTTTATCTCCAGG + Intergenic
1121440377 14:93945093-93945115 CAGTGGGGCTCCTTCTCTCCTGG + Intronic
1122822425 14:104354289-104354311 CCCAGGGCCCCTCTATCTCCAGG - Intergenic
1132314803 15:100881759-100881781 CAGTTGGGGCCTTTATCGCCTGG - Intronic
1134438973 16:14286203-14286225 CCCTGGGGCGCTTCATCCCCTGG + Intergenic
1135715287 16:24759581-24759603 CTGTGGCTCCCTCTATCTCCAGG - Intronic
1138009418 16:53363502-53363524 CCCTTGGGCCCTCTGTCTCCAGG + Intergenic
1139353277 16:66351219-66351241 TGCTGGGACCCTTTATCTCCTGG - Intergenic
1140116378 16:72045006-72045028 CCGTGGGACCCTGTAGCCCCTGG + Intronic
1141631796 16:85291783-85291805 CCGTGGGGCCCATAACCTCCTGG + Intergenic
1149578232 17:57728851-57728873 CCATGGGGCCCTTTAGATCCAGG + Intergenic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1151523495 17:74647853-74647875 CGGTGGTGTCCTTTATCTCCAGG - Intergenic
1151953087 17:77366012-77366034 CCCTGGGGCCCTTGGTGTCCTGG - Intronic
1152627136 17:81393069-81393091 CCGTGGGGCCCAGTCTCTCCTGG - Intergenic
1152739941 17:82014442-82014464 CCGTGGTGCCTTCTCTCTCCCGG + Intronic
1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG + Intronic
1157923299 18:51736220-51736242 ACGTGGTTCCCTTTGTCTCCAGG + Intergenic
1159027388 18:63196671-63196693 CCGTGCGGCCCTTTATCATACGG + Intronic
1159878366 18:73834555-73834577 CCCTGGAGACCTTTATCACCTGG - Intergenic
1160397052 18:78580244-78580266 CCCGGGGGCCCTTCATCTGCAGG - Intergenic
1162321185 19:9971221-9971243 CCTGGGGGCCCTAGATCTCCGGG + Exonic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
928595491 2:32855676-32855698 CTATGGGGCCCTTTATTTCTGGG + Intergenic
937065458 2:119013532-119013554 CCCGGTGGCACTTTATCTCCTGG + Intergenic
937868295 2:126770118-126770140 CCTTGGGTGCCTTTATCTCCTGG + Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1172719028 20:36985169-36985191 CCGGGAGGCCTTTTGTCTCCTGG - Intergenic
1172876338 20:38166530-38166552 CCGTGGGCCTCTGTCTCTCCGGG - Intronic
1176000390 20:62828947-62828969 CCGTTGGGGCCCTTCTCTCCCGG - Exonic
1176413544 21:6461734-6461756 CCCTGGAGCCCCTTATCTCAAGG + Intergenic
1179689041 21:43070057-43070079 CCCTGGAGCCCCTTATCTCAAGG + Intronic
1180333619 22:11555828-11555850 CCGTGGGGCCTCTTATCAGCTGG + Intergenic
1180988069 22:19917281-19917303 CTGTGGGGCTCTGTATCCCCTGG - Intronic
1184554877 22:45227715-45227737 CAGTGGGGCCCGTTCTCTCCCGG - Intronic
949871945 3:8596559-8596581 CTGTGGGCCCTTTTATCTCCAGG + Intergenic
951476927 3:23117072-23117094 CCCTGGGACCCCTTACCTCCTGG - Intergenic
952826704 3:37530501-37530523 CCCTGGGGCCACCTATCTCCAGG - Intronic
952874881 3:37936253-37936275 CCCTGGGGACATTTATCTCATGG + Intronic
961904345 3:130247033-130247055 CTTTGGGGCCCTTTATACCCTGG - Intergenic
962744862 3:138389689-138389711 TAGTGGGTCCCTTTAACTCCTGG + Intronic
964706549 3:159624755-159624777 CCTTGGGGCCCTGGATCTCTGGG - Intronic
999663348 5:153888497-153888519 CCGTTGGGCCCCACATCTCCTGG - Intergenic
1002182475 5:177437957-177437979 CAGTGGGCCTCATTATCTCCAGG - Intronic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1005989935 6:30896519-30896541 CCGGAGGGCCCTGTGTCTCCCGG - Intronic
1007737096 6:43988365-43988387 CAGGGGAGCCCCTTATCTCCTGG - Intergenic
1010937760 6:81882240-81882262 CTGTTGGGACCTTTTTCTCCTGG - Intergenic
1016871327 6:148819985-148820007 CCATGGGGGCCTCTCTCTCCGGG + Intronic
1024005623 7:45223458-45223480 CAGTGAGTCCCTTTATCCCCCGG + Intergenic
1026735542 7:72946378-72946400 CCCTGGGGCCCTTTCCCTTCTGG + Intronic
1026785880 7:73301308-73301330 CCCTGGGGCCCTTTCCCTTCTGG + Intergenic
1027108184 7:75418630-75418652 CCCTGGGGCCCTTTCCCTTCTGG - Exonic
1033544331 7:142386204-142386226 CTGTGTGACCCTTTGTCTCCTGG + Intergenic
1033545033 7:142391958-142391980 CTGTGTGGCCTTTTGTCTCCTGG + Intergenic
1033547543 7:142415241-142415263 CTGTGTGTCCCTTTATATCCTGG + Intergenic
1033570091 7:142619077-142619099 CTGTGTGGTCCTTTGTCTCCTGG + Intergenic
1033573449 7:142656757-142656779 CTGTGGGGCCTTTTATCTCCTGG + Intergenic
1033608006 7:142941510-142941532 CCTTGGGGCACTTGATCCCCTGG - Intronic
1034415049 7:150959845-150959867 CCGTATGGCCCTTCCTCTCCGGG + Intronic
1034950168 7:155291511-155291533 CTGTGGGGCCCTCTTCCTCCCGG + Intergenic
1035079212 7:156202333-156202355 CCTTGGGGCCATCTCTCTCCTGG - Intergenic
1035649361 8:1253309-1253331 GCCAGGGCCCCTTTATCTCCCGG + Intergenic
1039953786 8:42191876-42191898 CCGTGAGGCCCTTTATTGCTAGG + Intronic
1052886053 9:33649151-33649173 CTGTGTGGCCTTTTGTCTCCTGG + Intergenic
1053428975 9:38029261-38029283 CTATGGGGCCATTTCTCTCCAGG + Intronic
1056529108 9:87471187-87471209 CTGTTGGACCCTTTATCTCCTGG + Intergenic
1056715378 9:89024207-89024229 CCTTGAAGCCCTTTCTCTCCTGG + Intronic
1060813910 9:126625052-126625074 CCGCGGGGCCCTTTGTCCCACGG + Intronic
1062527850 9:136985485-136985507 CCGCGGGGCCCTCTACCTTCGGG + Exonic
1189260946 X:39678492-39678514 CAGTGGGGACATTTATCACCCGG + Intergenic
1190376794 X:49796191-49796213 CCTTGGGGGCCTTTCTCTCAGGG + Intergenic
1193358897 X:80556621-80556643 ACCTGAGGCCCTTTGTCTCCTGG - Intergenic
1195791397 X:108591605-108591627 CCTTGGAGTCCTTTATCACCTGG - Exonic
1198528003 X:137521595-137521617 CCGTGGACACCATTATCTCCTGG + Intergenic